Polymerase Chain Reaction:Article Title: Lung cDC1 and cDC2 dendritic cells priming naive CD8 + T cells in situ prior to migration to draining lymph nodes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ionomycin Sigma-Aldrich Cat# I3909-1ML Brefeldin A Sigma-Aldrich Cat# B6542-5MG PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# MINI26-1KT Pertussis toxin from Bordetella pertussis Sigma-Aldrich Cat# P7208-50UG Collagenase Sigma-Aldrich Cat# C5138-1G-PW DNase I (Deoxyribonuclease I) WORTHINGTON BIOCHEMICAL CORP CAT# LS002138 ODN 1826 (TYPE B) ENDOTO 1 MG Fisher Scientific Cat# 50596710 Ketamine Par Pharmaceutical, Inc NDC:42023-113-10 Xylazine Lloyd Laboratories NADA #139-236 Random Access 96 well Skirted PCR Plate Thomas Scientific Cat# 4ti-0960/RA DPBS Genesee Scientific Cat #: 25-508 Critical commercial assays Zombie NIRTM Fixable Viability Kit BioLegend Cat# 423105 UltraComp eBeadsTM Compensation Beads Invitrogen Cat# 501129040 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34554 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523 LS Columns Miltenyi Biotec Cat# 130-042-401 CD11c MicroBeads UltraPure, mouse Miltenyi Biotec Cat# 130-125-835 CD45 MicroBeads, mouse Miltenyi Biotec Cat# 130-052-301 CD8a+ T cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-104-075 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1024 Nextera XT Index Kit (24 indexes, 96 samples) Illumina Cat# FC-131-1001 HiSeq PE150 lane sequencing Novogene Corporation Inc N/A Experimental models: Cell lines B3Z T cellT-cell hybridomas Hans Lab, The University of Chicago N/A Experimental models: Organisms/strains Mouse: C57BL/6 Harlan - Envigo 71236(6) HSD Mouse: Batf3 / (B6.129S(C)-Batf3tm1Kmm/J) Jackson Laboratory Stock# 013755 Mouse: CD4KO (B6.129S2-Cd4tm1Mak/J) Jackson Laboratory Stock# 002663 Mouse: OT-1 TCR-Tg Rag1 knockout CD45.1 Huang Lab, The University of Chicago N/A Deposited data RNA-seq data This paper GEO: GSE216097, GSE216098, GSE216099 Software and algorithms FlowJo v10.5.3 FlowJo, LLC https://www.flowjo.com/ Prism 8 GraphPad https://www.graphpad.com/ ..
Article Title: Isolation and transcriptional profiling of antigen-presenting cells from mouse lung and MLNs following intranasal immunization.
Article Snippet: Wang et al., STAR Protocols 5, 103400 December 20, 2024 a 2024 Dendritic cells (DCs) play a central role in the initiation of the adaptive immune response.. Here, we present a protocol for isolating and transcriptionally profiling antigen-presenting cells (APCs) from the mouse lung andmediastinal lymph nodes (MLNs) following intranasal immunization.. We describe steps for preparing single-cell suspensions from the lung and MLN, along with the detection and RNA sequencing (RNA-seq) of antigen-presenting DCs.
Article Title: Molecular underpinnings and environmental drivers of loss of heterozygosity in Drosophila intestinal stem cells.
Article Snippet: .. Cell Reports 42, 113485, December 26, 2023 13 Article ll OPEN ACCESS STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Delta ECD (1:1000) DSHB Cat# c594.9b, RRID: AB_528194 Mouse anti-Prospero (1:1000) DSHB Cat# Prospero (MR1A-c) RRID: AB_528440 Chicken anti-GFP (1:2000) Invitrogen Cat# A10262 RRID: AB_2534023 Rabbit anti-Histone H2AvD pS137 (1:1000) Rockland Cat# 600-401-914 RRID: AB_828383 Rabbit anti-PH3 (1:2000) Millipore Cat# 06–570 RRID: AB_310177 Chemicals, peptides, and recombinant proteins RNAscope probes – Pif1 ACD bioteche NM_001298658.1 RNAscope probes – SpnA ACD bioteche NM_079844.4 Critical commercial assays QIAquick PCR Purification Kit Qiagen Cat# 28104 QIAmp DNA Micro Kit Qiagen Cat# 56304 RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Cat#323100 Nextera XT DNA Library Prep Kit Illumina Cat# FC-121-1030 KAPA HyperPlus Kit ROCHE Cat#07962380001 KAPA Library Quanitification Kits ROCHE Cat#07960140001 Deposited data NCBI BioProject database NCBI: PRJNA858414 https://www.ncbi.nlm.nih.gov/bioproject/ Experimental models: Organisms/strains Drosophila: UAS-GFPnls Bloomington Drosophila Stock Center RRID:BDSC_4776 Drosophila: SpnA093 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: SpnA057 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: w[1118] M. McVey N/A Drosophila: Gen[z4325] J. Sekelsky (Andersen, 2011)95 N/A Drosophila: mus81[nhe1] J. Sekelsky (Trowbridge, 2007)96 N/A Drosophila: prosvoila-GAL4 J. .. De Navascués (Balakireva, 1998)97 N/A Drosophila: Su(H)D47 F. Schweisguth RRID:BDSC_51215 Drosophila: UAS-DAP B. Edgar (Reis, 2004)65 N/A Drosophila: UAS-CycE,UAS-stg B. Edgar (Kohlmaier, 2015)66 N/A Drosophila: tubGAL80ts Dl-GAL4 B. Edgar (Zeng, 2010)98 N/A Drosophila: Rad51 (spnA)RNAi VDRC #13362 Drosophila: Pif1RNAi VDRC #34533 Drosophila: engrailed-GAL4 UAS-GFP Y. Bellaiche N/A Pseudomonas entomophila B. Lemaitre (Jiang et al., 2009)43 N/A (Continued on next page) 14 Cell Reports 42, 113485, December 26, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Erwinia carotovora carotovora 15 (Ecc15) B. Lemaitre (Buchon et al., 2009)42 N/A Software and algorithms Prism 9 GraphPad Software RRID:SCR_002798 Fiji NIH RRID:SCR_002285 bwa-mem version 0.7.17 H. Li arXiv:1303.3997v2 [q-bio.GN] FastQC S. Andrews http://www.bioinformatics.babraham. ac.uk/projects/fastqc bamstats bamstats https://biopet.github.io/bamstats/ 1.0.1/index.html multiqc mutliqc https://doi.org/10.1093/bioinformatics/btw354 SAMtools SAMtools https://www.htslib.org/ Gigascience.
Staining:Article Title: Lung cDC1 and cDC2 dendritic cells priming naive CD8 + T cells in situ prior to migration to draining lymph nodes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ionomycin Sigma-Aldrich Cat# I3909-1ML Brefeldin A Sigma-Aldrich Cat# B6542-5MG PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# MINI26-1KT Pertussis toxin from Bordetella pertussis Sigma-Aldrich Cat# P7208-50UG Collagenase Sigma-Aldrich Cat# C5138-1G-PW DNase I (Deoxyribonuclease I) WORTHINGTON BIOCHEMICAL CORP CAT# LS002138 ODN 1826 (TYPE B) ENDOTO 1 MG Fisher Scientific Cat# 50596710 Ketamine Par Pharmaceutical, Inc NDC:42023-113-10 Xylazine Lloyd Laboratories NADA #139-236 Random Access 96 well Skirted PCR Plate Thomas Scientific Cat# 4ti-0960/RA DPBS Genesee Scientific Cat #: 25-508 Critical commercial assays Zombie NIRTM Fixable Viability Kit BioLegend Cat# 423105 UltraComp eBeadsTM Compensation Beads Invitrogen Cat# 501129040 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34554 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523 LS Columns Miltenyi Biotec Cat# 130-042-401 CD11c MicroBeads UltraPure, mouse Miltenyi Biotec Cat# 130-125-835 CD45 MicroBeads, mouse Miltenyi Biotec Cat# 130-052-301 CD8a+ T cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-104-075 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1024 Nextera XT Index Kit (24 indexes, 96 samples) Illumina Cat# FC-131-1001 HiSeq PE150 lane sequencing Novogene Corporation Inc N/A Experimental models: Cell lines B3Z T cellT-cell hybridomas Hans Lab, The University of Chicago N/A Experimental models: Organisms/strains Mouse: C57BL/6 Harlan - Envigo 71236(6) HSD Mouse: Batf3 / (B6.129S(C)-Batf3tm1Kmm/J) Jackson Laboratory Stock# 013755 Mouse: CD4KO (B6.129S2-Cd4tm1Mak/J) Jackson Laboratory Stock# 002663 Mouse: OT-1 TCR-Tg Rag1 knockout CD45.1 Huang Lab, The University of Chicago N/A Deposited data RNA-seq data This paper GEO: GSE216097, GSE216098, GSE216099 Software and algorithms FlowJo v10.5.3 FlowJo, LLC https://www.flowjo.com/ Prism 8 GraphPad https://www.graphpad.com/ ..
Article Title: Oryza sativa Baby Boom1 converts the developmental fate of rice egg cells from gametic into somatic status
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples WT egg cells This study N/A DD45p::OsBBM1 egg cells This study N/A Chemicals, peptides, and recombinant proteins PrepManTM Ultra Sample Preparation Reagent Thermo Fisher Scientific, Warrington, UK REF 4318930 Agencourt AMPure XP beads Beckman Coulter, Brea, CA, USA Cat# NC9933872 SCRI Renaissance Stain 2200 Renaissance chemical, Japan SR2200 Critical commercial assays SMART-Seq HT Kit Takara Bio, Shiga, Japan Cat# 634456 Nextera® XT DNA Library Prep Kit Illumina, San Diego, CA, USA REF 15032350 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific, Waltham, MA, USA REF Q32852 Deposited data Sequencing data reported in this paper NCBI database PRJNA1256131 Experimental models: Rice plants Oryza sativa This study N/A DD45p::OsBBM1-2 This study N/A DD45p::OsBBM1-7 This study N/A DD45p::OsBBM1-8 This study N/A Oligonucleotides For primer used see Table S1 This study N/A For primer used see Table S7 This study N/A Recombinant DNA Plasmid: DD45p::OsBBM1 This study N/A Software and algorithms BX-73 inverted microscope Olympus, Japan N/A DP73 digital camera Olympus, Japan N/A cellSen® Standard Olympus, Japan N/A Nikon C2 confocal microscope (Ver.450) Nikon NIS-Elements AR, Tokyo, Japan N/A FastQC (v0.11.8) Simon46 https://www.bioinformatics.babraham.ac.uk/projects Cutadapt (v2.10) Martin47 https://doi.org/10.14806/ej.17.1.200 RSEM (v1.3.1) Li and Dewey48 http://www.biomedcentral.com/1471-2105/12/323 Bowtie2 (v 2.3.5.1) Langmead and Salzberg49 https://doi.org/10.1038/nmeth.1923 TCC (Tag Count Comparison) Sun et al.50 http://www.biomedcentral.com/1471-2105/14/219 GO analysis tool (agriGO v2.0) Tian et al.51 https://doi.org/10.1093/nar/gkx382 Other Oc Riken Bio-Resource Center, Tsukuba, Japan N/A e1 iScience 28, 113621, October 17, 2025 ..
Cell Isolation:Article Title: Lung cDC1 and cDC2 dendritic cells priming naive CD8 + T cells in situ prior to migration to draining lymph nodes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ionomycin Sigma-Aldrich Cat# I3909-1ML Brefeldin A Sigma-Aldrich Cat# B6542-5MG PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# MINI26-1KT Pertussis toxin from Bordetella pertussis Sigma-Aldrich Cat# P7208-50UG Collagenase Sigma-Aldrich Cat# C5138-1G-PW DNase I (Deoxyribonuclease I) WORTHINGTON BIOCHEMICAL CORP CAT# LS002138 ODN 1826 (TYPE B) ENDOTO 1 MG Fisher Scientific Cat# 50596710 Ketamine Par Pharmaceutical, Inc NDC:42023-113-10 Xylazine Lloyd Laboratories NADA #139-236 Random Access 96 well Skirted PCR Plate Thomas Scientific Cat# 4ti-0960/RA DPBS Genesee Scientific Cat #: 25-508 Critical commercial assays Zombie NIRTM Fixable Viability Kit BioLegend Cat# 423105 UltraComp eBeadsTM Compensation Beads Invitrogen Cat# 501129040 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34554 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523 LS Columns Miltenyi Biotec Cat# 130-042-401 CD11c MicroBeads UltraPure, mouse Miltenyi Biotec Cat# 130-125-835 CD45 MicroBeads, mouse Miltenyi Biotec Cat# 130-052-301 CD8a+ T cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-104-075 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1024 Nextera XT Index Kit (24 indexes, 96 samples) Illumina Cat# FC-131-1001 HiSeq PE150 lane sequencing Novogene Corporation Inc N/A Experimental models: Cell lines B3Z T cellT-cell hybridomas Hans Lab, The University of Chicago N/A Experimental models: Organisms/strains Mouse: C57BL/6 Harlan - Envigo 71236(6) HSD Mouse: Batf3 / (B6.129S(C)-Batf3tm1Kmm/J) Jackson Laboratory Stock# 013755 Mouse: CD4KO (B6.129S2-Cd4tm1Mak/J) Jackson Laboratory Stock# 002663 Mouse: OT-1 TCR-Tg Rag1 knockout CD45.1 Huang Lab, The University of Chicago N/A Deposited data RNA-seq data This paper GEO: GSE216097, GSE216098, GSE216099 Software and algorithms FlowJo v10.5.3 FlowJo, LLC https://www.flowjo.com/ Prism 8 GraphPad https://www.graphpad.com/ ..
Article Title: Physical and functional interaction among Irf8 enhancers during dendritic cell differentiation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotin-conjugated Armenian Hamster Anti-Mouse CD3ε (clone 145-2C11) BioLegend Cat# 100304 Biotin-conjugated Rat Anti-Mouse F4/80 (clone BM8) BioLegend Cat# 123106 Biotin-conjugated Rat Anti-mouse IL-7R (clone A7R34) BioLegend Cat# 135006 Biotin-conjugated Rat Anti-mouse Ly-6G (clone 1A8) BioLegend Cat# 127604 Biotin-conjugated Mouse Anti-Mouse NK1.1 (clone PK136) BD Biosciences Cat# 553163 Biotin-conjugated Rat Anti-Mouse Ter119 (clone TER-119) BioLegend Cat# 116204 Purified Rat anti-mouse CD16/32 (clone 93) BioLegend Cat# 101302 Rabbit Polyclonal Anti-Mouse Histone H3 (acetyl K27) Antibody Abcam Cat# ab4729 Guinea Pig Polyclonal Anti-Rabbit IgG (Heavy & Light Chain) Antibody Antibodies online Cat# ABIN101961 Acetyl-Histone H3 (Lys27) (D5E4) XP Rabbit mAb (PE Conjugate) Cell Signaling Cat# 15562S Rabbit (DA1E) mAb IgG XP Isotype Control (PE Conjugate) Cell Signaling Cat# 5742S Bacterial and virus strains MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A Chemicals, peptides, and recombinant proteins Liberase DL Roche Cat# 5466202001 DNase I, grade II, Roche Cat# 10104159001 Recombinant Murine SCF PeproTech Cat# 250-03 Recombinant Murine IL-3 PeproTech Cat# 213-13 Recombinant Murine IL-6 PeproTech Cat# 216-16 Recombinant Human Flt3-Ligand PeproTech Cat# 300-19 RPMI1640 Nacalai Tesque Cat# 30263-95 Fetal Bovine Serum (Lot# 0001641431) Sigma Cat# 173012 D-MEM FUJIFILM Wako Pure Chemical Cat# 043-30085 PEI MAX Polysciences Cat# 24765-1 Dpn II NEB Cat# R0543M Biotin-14-dATP Thermo Fisher Scientific Cat# 19524016 DNA Polymerase I, Large (Klenow) Fragment NEB Cat# M0210L T4 DNA Ligase NEB Cat# M0202M Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 KOD FX Neo polymerase Toyobo Cat# KFX-201 Agarose ME Iwai Chemicals Cat# 50013R Agarose H Nippon gene Cat# 319-01201 Marker 7 GT Nippon gene Cat# 315-03981 Atlas Clear Sight Gold DNA Stain solution BioAtlas Cat# BH40701 Blocking One-P Nacalai Tesque Cat# 05999-84 (Continued on next page) 14 Cell Reports 43, 114107, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Lineage Cell Depletion Kit, mouse Miltenyi Biotec Cat# 130-110-470 CD8+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-169 CD4+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-262 RNeasy Micro Kit Qiagen Cat# 74004 SMART-Seq HT Kit Takara Bio Cat# 634437 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1096 KAPA HyperPrep Kits Roche Cat# 07962347001 SureSelect XT HS Reagents Agilent Technologies Cat# G9702A SureSelect PostPool Custom Tier2 Agilent Technologies Cat# 5191-6905 PrimeScript RT Reagent kit Takara Bio Cat# RR037B THUNDERBIRD SYBR qPCR Mix Toyobo Cat# QPS-201 Deposited data RNA-seq data for wild-type CDPs, cDC1s and cDC2s Murakami et al.8 GEO: GSE149762 RNA-seq data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 ATAC-seq data for wild-type MDPs and CDPs Murakami et al.8 GEO: GSE149762 ATAC-seq data for wild-type cDC1s Brown et al.43 GEO: GSE130201 ChIP-seq data for wild-type LMPPs and MDPs Murakami et al.8 GEO: GSE149762 Tiled-C data This study DDBJ: DRA016834 H3K27ac CUT&Tag data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 Experimental models: Cell lines 293TN cell line System Biosciences Cat# LV900A-1 Experimental models: Organisms/strains Mouse: C57BL/6 Japan SLC C57BL/6JJmsSlc Mouse: Irf8 / : Irf8tm1Hor Holtschke et al.44 N/A Mouse: +32D/D Murakami et al.8 N/A Mouse: +56D/D Murakami et al.8 N/A Mouse: +32WT/D This study N/A Mouse: +56D/WT This study N/A Mouse: +56D/WT+32WT/D This study N/A Oligonucleotides Oligonucleotides used in this study, see Table S1 This study N/A Recombinant DNA MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A pCL-Eco Naviaux et al.45 N/A Software and algorithms FlowJo (version 10.8.1) BD Life Sciences Cat# 663335 STAR (version 2.7.7a) Dobin et al.46 https://github.com/alexdobin/STAR Picard (version 2.25.0) Broad Institute http://broadinstitute.github.io/picard/ RSEM (version 1.3.3) Li et al.47 https://github.com/deweylab/RSEM R (version 4.0.3) The R Foundation for Statistical Computing https://www.r-project.org/ (Continued on next page) Cell Reports 43, 114107, April 23, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER edgeR (version 3.32.1) Robinson et al.48 https://bioconductor.org/packages/ release/bioc/html/edgeR.html R Stats (version 4.3) R Core Team https://stat.ethz.ch/R-manual/R-devel/ library/stats/html/00Index.html ggplot2 (version 3.2.4) Hadley Wickham, https://ggplot2.tidyverse.org/ authors.html#citation https://ggplot2.tidyverse.org/ Bowtie2 (version 2.3.5.1) Langmead et al.49 https://bowtie-bio.sourceforge.net/ bowtie2/index.shtml HOMER (version 4.11) Heinz et al.50 http://homer.ucsd.edu/homer/index.html GOPHER (version 0.6.0) Hansen et al.51 https://github.com/TheJacksonLaboratory/Gopher Agilent SureDesign tool Agilent Technologies https://earray.chem.agilent.com/suredesign/ Hi-Cpro (version 3.0.0) Servant et al.52 https://github.com/nservant/HiC-Pro Treeview3 (version 3.0 Beta 1) Christopher Keil, https://doi.org/10.5281/ zenodo.1303402 https://bitbucket.org/TreeView3Dev/ treeview3/src/master/ GraphPad Prism 9 GraphPad https://www.graphpad.com GSEA software (version 4.0.3) Broad Institute53 https://www.gsea-msigdb.org/gsea/index.jsp
Sequencing:Article Title: Lung cDC1 and cDC2 dendritic cells priming naive CD8 + T cells in situ prior to migration to draining lymph nodes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ionomycin Sigma-Aldrich Cat# I3909-1ML Brefeldin A Sigma-Aldrich Cat# B6542-5MG PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# MINI26-1KT Pertussis toxin from Bordetella pertussis Sigma-Aldrich Cat# P7208-50UG Collagenase Sigma-Aldrich Cat# C5138-1G-PW DNase I (Deoxyribonuclease I) WORTHINGTON BIOCHEMICAL CORP CAT# LS002138 ODN 1826 (TYPE B) ENDOTO 1 MG Fisher Scientific Cat# 50596710 Ketamine Par Pharmaceutical, Inc NDC:42023-113-10 Xylazine Lloyd Laboratories NADA #139-236 Random Access 96 well Skirted PCR Plate Thomas Scientific Cat# 4ti-0960/RA DPBS Genesee Scientific Cat #: 25-508 Critical commercial assays Zombie NIRTM Fixable Viability Kit BioLegend Cat# 423105 UltraComp eBeadsTM Compensation Beads Invitrogen Cat# 501129040 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34554 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523 LS Columns Miltenyi Biotec Cat# 130-042-401 CD11c MicroBeads UltraPure, mouse Miltenyi Biotec Cat# 130-125-835 CD45 MicroBeads, mouse Miltenyi Biotec Cat# 130-052-301 CD8a+ T cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-104-075 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1024 Nextera XT Index Kit (24 indexes, 96 samples) Illumina Cat# FC-131-1001 HiSeq PE150 lane sequencing Novogene Corporation Inc N/A Experimental models: Cell lines B3Z T cellT-cell hybridomas Hans Lab, The University of Chicago N/A Experimental models: Organisms/strains Mouse: C57BL/6 Harlan - Envigo 71236(6) HSD Mouse: Batf3 / (B6.129S(C)-Batf3tm1Kmm/J) Jackson Laboratory Stock# 013755 Mouse: CD4KO (B6.129S2-Cd4tm1Mak/J) Jackson Laboratory Stock# 002663 Mouse: OT-1 TCR-Tg Rag1 knockout CD45.1 Huang Lab, The University of Chicago N/A Deposited data RNA-seq data This paper GEO: GSE216097, GSE216098, GSE216099 Software and algorithms FlowJo v10.5.3 FlowJo, LLC https://www.flowjo.com/ Prism 8 GraphPad https://www.graphpad.com/ ..
Article Title: Oryza sativa Baby Boom1 converts the developmental fate of rice egg cells from gametic into somatic status
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples WT egg cells This study N/A DD45p::OsBBM1 egg cells This study N/A Chemicals, peptides, and recombinant proteins PrepManTM Ultra Sample Preparation Reagent Thermo Fisher Scientific, Warrington, UK REF 4318930 Agencourt AMPure XP beads Beckman Coulter, Brea, CA, USA Cat# NC9933872 SCRI Renaissance Stain 2200 Renaissance chemical, Japan SR2200 Critical commercial assays SMART-Seq HT Kit Takara Bio, Shiga, Japan Cat# 634456 Nextera® XT DNA Library Prep Kit Illumina, San Diego, CA, USA REF 15032350 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific, Waltham, MA, USA REF Q32852 Deposited data Sequencing data reported in this paper NCBI database PRJNA1256131 Experimental models: Rice plants Oryza sativa This study N/A DD45p::OsBBM1-2 This study N/A DD45p::OsBBM1-7 This study N/A DD45p::OsBBM1-8 This study N/A Oligonucleotides For primer used see Table S1 This study N/A For primer used see Table S7 This study N/A Recombinant DNA Plasmid: DD45p::OsBBM1 This study N/A Software and algorithms BX-73 inverted microscope Olympus, Japan N/A DP73 digital camera Olympus, Japan N/A cellSen® Standard Olympus, Japan N/A Nikon C2 confocal microscope (Ver.450) Nikon NIS-Elements AR, Tokyo, Japan N/A FastQC (v0.11.8) Simon46 https://www.bioinformatics.babraham.ac.uk/projects Cutadapt (v2.10) Martin47 https://doi.org/10.14806/ej.17.1.200 RSEM (v1.3.1) Li and Dewey48 http://www.biomedcentral.com/1471-2105/12/323 Bowtie2 (v 2.3.5.1) Langmead and Salzberg49 https://doi.org/10.1038/nmeth.1923 TCC (Tag Count Comparison) Sun et al.50 http://www.biomedcentral.com/1471-2105/14/219 GO analysis tool (agriGO v2.0) Tian et al.51 https://doi.org/10.1093/nar/gkx382 Other Oc Riken Bio-Resource Center, Tsukuba, Japan N/A e1 iScience 28, 113621, October 17, 2025 ..
Knock-Out:Article Title: Lung cDC1 and cDC2 dendritic cells priming naive CD8 + T cells in situ prior to migration to draining lymph nodes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ionomycin Sigma-Aldrich Cat# I3909-1ML Brefeldin A Sigma-Aldrich Cat# B6542-5MG PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# MINI26-1KT Pertussis toxin from Bordetella pertussis Sigma-Aldrich Cat# P7208-50UG Collagenase Sigma-Aldrich Cat# C5138-1G-PW DNase I (Deoxyribonuclease I) WORTHINGTON BIOCHEMICAL CORP CAT# LS002138 ODN 1826 (TYPE B) ENDOTO 1 MG Fisher Scientific Cat# 50596710 Ketamine Par Pharmaceutical, Inc NDC:42023-113-10 Xylazine Lloyd Laboratories NADA #139-236 Random Access 96 well Skirted PCR Plate Thomas Scientific Cat# 4ti-0960/RA DPBS Genesee Scientific Cat #: 25-508 Critical commercial assays Zombie NIRTM Fixable Viability Kit BioLegend Cat# 423105 UltraComp eBeadsTM Compensation Beads Invitrogen Cat# 501129040 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34554 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523 LS Columns Miltenyi Biotec Cat# 130-042-401 CD11c MicroBeads UltraPure, mouse Miltenyi Biotec Cat# 130-125-835 CD45 MicroBeads, mouse Miltenyi Biotec Cat# 130-052-301 CD8a+ T cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-104-075 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1024 Nextera XT Index Kit (24 indexes, 96 samples) Illumina Cat# FC-131-1001 HiSeq PE150 lane sequencing Novogene Corporation Inc N/A Experimental models: Cell lines B3Z T cellT-cell hybridomas Hans Lab, The University of Chicago N/A Experimental models: Organisms/strains Mouse: C57BL/6 Harlan - Envigo 71236(6) HSD Mouse: Batf3 / (B6.129S(C)-Batf3tm1Kmm/J) Jackson Laboratory Stock# 013755 Mouse: CD4KO (B6.129S2-Cd4tm1Mak/J) Jackson Laboratory Stock# 002663 Mouse: OT-1 TCR-Tg Rag1 knockout CD45.1 Huang Lab, The University of Chicago N/A Deposited data RNA-seq data This paper GEO: GSE216097, GSE216098, GSE216099 Software and algorithms FlowJo v10.5.3 FlowJo, LLC https://www.flowjo.com/ Prism 8 GraphPad https://www.graphpad.com/ ..
RNA Sequencing:Article Title: Lung cDC1 and cDC2 dendritic cells priming naive CD8 + T cells in situ prior to migration to draining lymph nodes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ionomycin Sigma-Aldrich Cat# I3909-1ML Brefeldin A Sigma-Aldrich Cat# B6542-5MG PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# MINI26-1KT Pertussis toxin from Bordetella pertussis Sigma-Aldrich Cat# P7208-50UG Collagenase Sigma-Aldrich Cat# C5138-1G-PW DNase I (Deoxyribonuclease I) WORTHINGTON BIOCHEMICAL CORP CAT# LS002138 ODN 1826 (TYPE B) ENDOTO 1 MG Fisher Scientific Cat# 50596710 Ketamine Par Pharmaceutical, Inc NDC:42023-113-10 Xylazine Lloyd Laboratories NADA #139-236 Random Access 96 well Skirted PCR Plate Thomas Scientific Cat# 4ti-0960/RA DPBS Genesee Scientific Cat #: 25-508 Critical commercial assays Zombie NIRTM Fixable Viability Kit BioLegend Cat# 423105 UltraComp eBeadsTM Compensation Beads Invitrogen Cat# 501129040 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34554 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523 LS Columns Miltenyi Biotec Cat# 130-042-401 CD11c MicroBeads UltraPure, mouse Miltenyi Biotec Cat# 130-125-835 CD45 MicroBeads, mouse Miltenyi Biotec Cat# 130-052-301 CD8a+ T cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-104-075 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1024 Nextera XT Index Kit (24 indexes, 96 samples) Illumina Cat# FC-131-1001 HiSeq PE150 lane sequencing Novogene Corporation Inc N/A Experimental models: Cell lines B3Z T cellT-cell hybridomas Hans Lab, The University of Chicago N/A Experimental models: Organisms/strains Mouse: C57BL/6 Harlan - Envigo 71236(6) HSD Mouse: Batf3 / (B6.129S(C)-Batf3tm1Kmm/J) Jackson Laboratory Stock# 013755 Mouse: CD4KO (B6.129S2-Cd4tm1Mak/J) Jackson Laboratory Stock# 002663 Mouse: OT-1 TCR-Tg Rag1 knockout CD45.1 Huang Lab, The University of Chicago N/A Deposited data RNA-seq data This paper GEO: GSE216097, GSE216098, GSE216099 Software and algorithms FlowJo v10.5.3 FlowJo, LLC https://www.flowjo.com/ Prism 8 GraphPad https://www.graphpad.com/ ..
Article Title: Physical and functional interaction among Irf8 enhancers during dendritic cell differentiation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotin-conjugated Armenian Hamster Anti-Mouse CD3ε (clone 145-2C11) BioLegend Cat# 100304 Biotin-conjugated Rat Anti-Mouse F4/80 (clone BM8) BioLegend Cat# 123106 Biotin-conjugated Rat Anti-mouse IL-7R (clone A7R34) BioLegend Cat# 135006 Biotin-conjugated Rat Anti-mouse Ly-6G (clone 1A8) BioLegend Cat# 127604 Biotin-conjugated Mouse Anti-Mouse NK1.1 (clone PK136) BD Biosciences Cat# 553163 Biotin-conjugated Rat Anti-Mouse Ter119 (clone TER-119) BioLegend Cat# 116204 Purified Rat anti-mouse CD16/32 (clone 93) BioLegend Cat# 101302 Rabbit Polyclonal Anti-Mouse Histone H3 (acetyl K27) Antibody Abcam Cat# ab4729 Guinea Pig Polyclonal Anti-Rabbit IgG (Heavy & Light Chain) Antibody Antibodies online Cat# ABIN101961 Acetyl-Histone H3 (Lys27) (D5E4) XP Rabbit mAb (PE Conjugate) Cell Signaling Cat# 15562S Rabbit (DA1E) mAb IgG XP Isotype Control (PE Conjugate) Cell Signaling Cat# 5742S Bacterial and virus strains MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A Chemicals, peptides, and recombinant proteins Liberase DL Roche Cat# 5466202001 DNase I, grade II, Roche Cat# 10104159001 Recombinant Murine SCF PeproTech Cat# 250-03 Recombinant Murine IL-3 PeproTech Cat# 213-13 Recombinant Murine IL-6 PeproTech Cat# 216-16 Recombinant Human Flt3-Ligand PeproTech Cat# 300-19 RPMI1640 Nacalai Tesque Cat# 30263-95 Fetal Bovine Serum (Lot# 0001641431) Sigma Cat# 173012 D-MEM FUJIFILM Wako Pure Chemical Cat# 043-30085 PEI MAX Polysciences Cat# 24765-1 Dpn II NEB Cat# R0543M Biotin-14-dATP Thermo Fisher Scientific Cat# 19524016 DNA Polymerase I, Large (Klenow) Fragment NEB Cat# M0210L T4 DNA Ligase NEB Cat# M0202M Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 KOD FX Neo polymerase Toyobo Cat# KFX-201 Agarose ME Iwai Chemicals Cat# 50013R Agarose H Nippon gene Cat# 319-01201 Marker 7 GT Nippon gene Cat# 315-03981 Atlas Clear Sight Gold DNA Stain solution BioAtlas Cat# BH40701 Blocking One-P Nacalai Tesque Cat# 05999-84 (Continued on next page) 14 Cell Reports 43, 114107, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Lineage Cell Depletion Kit, mouse Miltenyi Biotec Cat# 130-110-470 CD8+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-169 CD4+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-262 RNeasy Micro Kit Qiagen Cat# 74004 SMART-Seq HT Kit Takara Bio Cat# 634437 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1096 KAPA HyperPrep Kits Roche Cat# 07962347001 SureSelect XT HS Reagents Agilent Technologies Cat# G9702A SureSelect PostPool Custom Tier2 Agilent Technologies Cat# 5191-6905 PrimeScript RT Reagent kit Takara Bio Cat# RR037B THUNDERBIRD SYBR qPCR Mix Toyobo Cat# QPS-201 Deposited data RNA-seq data for wild-type CDPs, cDC1s and cDC2s Murakami et al.8 GEO: GSE149762 RNA-seq data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 ATAC-seq data for wild-type MDPs and CDPs Murakami et al.8 GEO: GSE149762 ATAC-seq data for wild-type cDC1s Brown et al.43 GEO: GSE130201 ChIP-seq data for wild-type LMPPs and MDPs Murakami et al.8 GEO: GSE149762 Tiled-C data This study DDBJ: DRA016834 H3K27ac CUT&Tag data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 Experimental models: Cell lines 293TN cell line System Biosciences Cat# LV900A-1 Experimental models: Organisms/strains Mouse: C57BL/6 Japan SLC C57BL/6JJmsSlc Mouse: Irf8 / : Irf8tm1Hor Holtschke et al.44 N/A Mouse: +32D/D Murakami et al.8 N/A Mouse: +56D/D Murakami et al.8 N/A Mouse: +32WT/D This study N/A Mouse: +56D/WT This study N/A Mouse: +56D/WT+32WT/D This study N/A Oligonucleotides Oligonucleotides used in this study, see Table S1 This study N/A Recombinant DNA MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A pCL-Eco Naviaux et al.45 N/A Software and algorithms FlowJo (version 10.8.1) BD Life Sciences Cat# 663335 STAR (version 2.7.7a) Dobin et al.46 https://github.com/alexdobin/STAR Picard (version 2.25.0) Broad Institute http://broadinstitute.github.io/picard/ RSEM (version 1.3.3) Li et al.47 https://github.com/deweylab/RSEM R (version 4.0.3) The R Foundation for Statistical Computing https://www.r-project.org/ (Continued on next page) Cell Reports 43, 114107, April 23, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER edgeR (version 3.32.1) Robinson et al.48 https://bioconductor.org/packages/ release/bioc/html/edgeR.html R Stats (version 4.3) R Core Team https://stat.ethz.ch/R-manual/R-devel/ library/stats/html/00Index.html ggplot2 (version 3.2.4) Hadley Wickham, https://ggplot2.tidyverse.org/ authors.html#citation https://ggplot2.tidyverse.org/ Bowtie2 (version 2.3.5.1) Langmead et al.49 https://bowtie-bio.sourceforge.net/ bowtie2/index.shtml HOMER (version 4.11) Heinz et al.50 http://homer.ucsd.edu/homer/index.html GOPHER (version 0.6.0) Hansen et al.51 https://github.com/TheJacksonLaboratory/Gopher Agilent SureDesign tool Agilent Technologies https://earray.chem.agilent.com/suredesign/ Hi-Cpro (version 3.0.0) Servant et al.52 https://github.com/nservant/HiC-Pro Treeview3 (version 3.0 Beta 1) Christopher Keil, https://doi.org/10.5281/ zenodo.1303402 https://bitbucket.org/TreeView3Dev/ treeview3/src/master/ GraphPad Prism 9 GraphPad https://www.graphpad.com GSEA software (version 4.0.3) Broad Institute53 https://www.gsea-msigdb.org/gsea/index.jsp
Article Title: Isolation and transcriptional profiling of antigen-presenting cells from mouse lung and MLNs following intranasal immunization.
Article Snippet: Wang et al., STAR Protocols 5, 103400 December 20, 2024 a 2024 Dendritic cells (DCs) play a central role in the initiation of the adaptive immune response.. Here, we present a protocol for isolating and transcriptionally profiling antigen-presenting cells (APCs) from the mouse lung andmediastinal lymph nodes (MLNs) following intranasal immunization.. We describe steps for preparing single-cell suspensions from the lung and MLN, along with the detection and RNA sequencing (RNA-seq) of antigen-presenting DCs.
Software:Article Title: Lung cDC1 and cDC2 dendritic cells priming naive CD8 + T cells in situ prior to migration to draining lymph nodes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ionomycin Sigma-Aldrich Cat# I3909-1ML Brefeldin A Sigma-Aldrich Cat# B6542-5MG PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# MINI26-1KT Pertussis toxin from Bordetella pertussis Sigma-Aldrich Cat# P7208-50UG Collagenase Sigma-Aldrich Cat# C5138-1G-PW DNase I (Deoxyribonuclease I) WORTHINGTON BIOCHEMICAL CORP CAT# LS002138 ODN 1826 (TYPE B) ENDOTO 1 MG Fisher Scientific Cat# 50596710 Ketamine Par Pharmaceutical, Inc NDC:42023-113-10 Xylazine Lloyd Laboratories NADA #139-236 Random Access 96 well Skirted PCR Plate Thomas Scientific Cat# 4ti-0960/RA DPBS Genesee Scientific Cat #: 25-508 Critical commercial assays Zombie NIRTM Fixable Viability Kit BioLegend Cat# 423105 UltraComp eBeadsTM Compensation Beads Invitrogen Cat# 501129040 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34554 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523 LS Columns Miltenyi Biotec Cat# 130-042-401 CD11c MicroBeads UltraPure, mouse Miltenyi Biotec Cat# 130-125-835 CD45 MicroBeads, mouse Miltenyi Biotec Cat# 130-052-301 CD8a+ T cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-104-075 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1024 Nextera XT Index Kit (24 indexes, 96 samples) Illumina Cat# FC-131-1001 HiSeq PE150 lane sequencing Novogene Corporation Inc N/A Experimental models: Cell lines B3Z T cellT-cell hybridomas Hans Lab, The University of Chicago N/A Experimental models: Organisms/strains Mouse: C57BL/6 Harlan - Envigo 71236(6) HSD Mouse: Batf3 / (B6.129S(C)-Batf3tm1Kmm/J) Jackson Laboratory Stock# 013755 Mouse: CD4KO (B6.129S2-Cd4tm1Mak/J) Jackson Laboratory Stock# 002663 Mouse: OT-1 TCR-Tg Rag1 knockout CD45.1 Huang Lab, The University of Chicago N/A Deposited data RNA-seq data This paper GEO: GSE216097, GSE216098, GSE216099 Software and algorithms FlowJo v10.5.3 FlowJo, LLC https://www.flowjo.com/ Prism 8 GraphPad https://www.graphpad.com/ ..
Article Title: Early-life B cell memory is archived in the mouse B-1 cell compartment and drives chronic lymphocytic leukemia-like disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Draq7 BD Biosciences Cat# 564904 Alexa Fluor 488 Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Pacific Blue Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Critical commercial assays Cytofix/Cytoperm Kit BD Biosciences Cat# BDB554714 Mouse Immune Single-Cell Multiplexing Kit BD Biosciences Cat# 633793 AMPure XP Reagent Beckman Coulter Cat# A63880 dsDNA HS Assay Kit Fisher Scientific Cat# 10606433 High Sensitivity DNA Kit Agilent Cat# 5067-4626 S1 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028318 Direct-zol RNA MiniPrep Kit Zymo Research Cat# R2050 SMARTScribe Reverse Transcriptase Takara Bio Cat# 639537 Q5 High-Fidelity DNA Polymerase New England Biolabs Cat# M0491 Nextera XT Index Kit v2 SetA Illumina Cat# 15052163 MiSeq Reagent Kit v3 (600 cycles) Illumina Cat# MS-102-3003 SMART-Seq v4 Ultra Low Input RNA Kit Takara Bio Cat# 634889 Nextera XT DNA library prep Kit Illumina Cat# FC-131-1024 DNA/RNA UD Indexes Set A Illumina Cat# 200027213 S4 Reagent Kit v1.5 (300 cycle XP) Illumina Cat# 20028312 Deposited data Single-cell RNA-Seq data This paper GEO: GSE314339 ATAC-Seq data This paper GEO: GSE309960 Bulk VDJ-Seq data This paper GEO: GSE314340 Bulk RNA-Seq data This paper GEO: GSE314338 Experimental models: Organisms/strains B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ Hobeika et al.76 JAX 033026 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J Madisen et al.77 JAX 007909 Eμ-TCL-1 tg Laboratory of P. Ghia45 NA Oligonucleotides Template Switching Oligonucleotide (TSO) IDT 5′/BiosG/AAGCAGTGGTArUCAA CGCAGAGrUTCAGTGrGrGrG-3′ IgHM Reverse Primer IDT 5′CTGATACCCTGGATGACTTC-3′ TSO Amplification Forward Primer IDT 5′TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGAAGCAGTGGTATC AACGCAGAGT-3′ IgHM Reverse Primer (with Illumina adaptor) IDT 5′GTCTCGTGGGCTCGGAGAT GTGTATAAGAGACAGGGAA GACATTTGGGAAGGACTGACT-3′ Software and algorithms R v4.4.0 R Core Team www.R-project.org Change-O v1.3.0 Immcantation Portal https://changeo.readthedocs.io/en/stable/# pResto v0.7.1 Immcantation Portal https://presto.readthedocs.io/en/stable/ ShazaM v1.2.0 Immcantation Portal https://shazam.readthedocs.io/en/stable/ Seurat v5.1.0 Satija Laboratory https://satijalab.org/seurat/ DESeq2 v1.42.1 and v1.46.0 Bioconductor https://bioconductor.org/packages/release/ bioc/html/DESeq2.html nf-core/rnaseq v3.14 nf-core https://nf-co.re/rnaseq/3.14.0/ (Continued on next page) Cell Reports 45, 117202, April 28, 2026 17 .. Mb1Cre− ERT2 mice (JAX 033026 B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ)76 were crossed to R26fl− STOP-Tom reporter mice (JAX 007909 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J)77 to generate time-stampable mice heterozygous for both alleles.
Article Title: Physical and functional interaction among Irf8 enhancers during dendritic cell differentiation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotin-conjugated Armenian Hamster Anti-Mouse CD3ε (clone 145-2C11) BioLegend Cat# 100304 Biotin-conjugated Rat Anti-Mouse F4/80 (clone BM8) BioLegend Cat# 123106 Biotin-conjugated Rat Anti-mouse IL-7R (clone A7R34) BioLegend Cat# 135006 Biotin-conjugated Rat Anti-mouse Ly-6G (clone 1A8) BioLegend Cat# 127604 Biotin-conjugated Mouse Anti-Mouse NK1.1 (clone PK136) BD Biosciences Cat# 553163 Biotin-conjugated Rat Anti-Mouse Ter119 (clone TER-119) BioLegend Cat# 116204 Purified Rat anti-mouse CD16/32 (clone 93) BioLegend Cat# 101302 Rabbit Polyclonal Anti-Mouse Histone H3 (acetyl K27) Antibody Abcam Cat# ab4729 Guinea Pig Polyclonal Anti-Rabbit IgG (Heavy & Light Chain) Antibody Antibodies online Cat# ABIN101961 Acetyl-Histone H3 (Lys27) (D5E4) XP Rabbit mAb (PE Conjugate) Cell Signaling Cat# 15562S Rabbit (DA1E) mAb IgG XP Isotype Control (PE Conjugate) Cell Signaling Cat# 5742S Bacterial and virus strains MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A Chemicals, peptides, and recombinant proteins Liberase DL Roche Cat# 5466202001 DNase I, grade II, Roche Cat# 10104159001 Recombinant Murine SCF PeproTech Cat# 250-03 Recombinant Murine IL-3 PeproTech Cat# 213-13 Recombinant Murine IL-6 PeproTech Cat# 216-16 Recombinant Human Flt3-Ligand PeproTech Cat# 300-19 RPMI1640 Nacalai Tesque Cat# 30263-95 Fetal Bovine Serum (Lot# 0001641431) Sigma Cat# 173012 D-MEM FUJIFILM Wako Pure Chemical Cat# 043-30085 PEI MAX Polysciences Cat# 24765-1 Dpn II NEB Cat# R0543M Biotin-14-dATP Thermo Fisher Scientific Cat# 19524016 DNA Polymerase I, Large (Klenow) Fragment NEB Cat# M0210L T4 DNA Ligase NEB Cat# M0202M Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 KOD FX Neo polymerase Toyobo Cat# KFX-201 Agarose ME Iwai Chemicals Cat# 50013R Agarose H Nippon gene Cat# 319-01201 Marker 7 GT Nippon gene Cat# 315-03981 Atlas Clear Sight Gold DNA Stain solution BioAtlas Cat# BH40701 Blocking One-P Nacalai Tesque Cat# 05999-84 (Continued on next page) 14 Cell Reports 43, 114107, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Lineage Cell Depletion Kit, mouse Miltenyi Biotec Cat# 130-110-470 CD8+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-169 CD4+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-262 RNeasy Micro Kit Qiagen Cat# 74004 SMART-Seq HT Kit Takara Bio Cat# 634437 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1096 KAPA HyperPrep Kits Roche Cat# 07962347001 SureSelect XT HS Reagents Agilent Technologies Cat# G9702A SureSelect PostPool Custom Tier2 Agilent Technologies Cat# 5191-6905 PrimeScript RT Reagent kit Takara Bio Cat# RR037B THUNDERBIRD SYBR qPCR Mix Toyobo Cat# QPS-201 Deposited data RNA-seq data for wild-type CDPs, cDC1s and cDC2s Murakami et al.8 GEO: GSE149762 RNA-seq data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 ATAC-seq data for wild-type MDPs and CDPs Murakami et al.8 GEO: GSE149762 ATAC-seq data for wild-type cDC1s Brown et al.43 GEO: GSE130201 ChIP-seq data for wild-type LMPPs and MDPs Murakami et al.8 GEO: GSE149762 Tiled-C data This study DDBJ: DRA016834 H3K27ac CUT&Tag data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 Experimental models: Cell lines 293TN cell line System Biosciences Cat# LV900A-1 Experimental models: Organisms/strains Mouse: C57BL/6 Japan SLC C57BL/6JJmsSlc Mouse: Irf8 / : Irf8tm1Hor Holtschke et al.44 N/A Mouse: +32D/D Murakami et al.8 N/A Mouse: +56D/D Murakami et al.8 N/A Mouse: +32WT/D This study N/A Mouse: +56D/WT This study N/A Mouse: +56D/WT+32WT/D This study N/A Oligonucleotides Oligonucleotides used in this study, see Table S1 This study N/A Recombinant DNA MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A pCL-Eco Naviaux et al.45 N/A Software and algorithms FlowJo (version 10.8.1) BD Life Sciences Cat# 663335 STAR (version 2.7.7a) Dobin et al.46 https://github.com/alexdobin/STAR Picard (version 2.25.0) Broad Institute http://broadinstitute.github.io/picard/ RSEM (version 1.3.3) Li et al.47 https://github.com/deweylab/RSEM R (version 4.0.3) The R Foundation for Statistical Computing https://www.r-project.org/ (Continued on next page) Cell Reports 43, 114107, April 23, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER edgeR (version 3.32.1) Robinson et al.48 https://bioconductor.org/packages/ release/bioc/html/edgeR.html R Stats (version 4.3) R Core Team https://stat.ethz.ch/R-manual/R-devel/ library/stats/html/00Index.html ggplot2 (version 3.2.4) Hadley Wickham, https://ggplot2.tidyverse.org/ authors.html#citation https://ggplot2.tidyverse.org/ Bowtie2 (version 2.3.5.1) Langmead et al.49 https://bowtie-bio.sourceforge.net/ bowtie2/index.shtml HOMER (version 4.11) Heinz et al.50 http://homer.ucsd.edu/homer/index.html GOPHER (version 0.6.0) Hansen et al.51 https://github.com/TheJacksonLaboratory/Gopher Agilent SureDesign tool Agilent Technologies https://earray.chem.agilent.com/suredesign/ Hi-Cpro (version 3.0.0) Servant et al.52 https://github.com/nservant/HiC-Pro Treeview3 (version 3.0 Beta 1) Christopher Keil, https://doi.org/10.5281/ zenodo.1303402 https://bitbucket.org/TreeView3Dev/ treeview3/src/master/ GraphPad Prism 9 GraphPad https://www.graphpad.com GSEA software (version 4.0.3) Broad Institute53 https://www.gsea-msigdb.org/gsea/index.jsp
Article Title: Oryza sativa Baby Boom1 converts the developmental fate of rice egg cells from gametic into somatic status
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples WT egg cells This study N/A DD45p::OsBBM1 egg cells This study N/A Chemicals, peptides, and recombinant proteins PrepManTM Ultra Sample Preparation Reagent Thermo Fisher Scientific, Warrington, UK REF 4318930 Agencourt AMPure XP beads Beckman Coulter, Brea, CA, USA Cat# NC9933872 SCRI Renaissance Stain 2200 Renaissance chemical, Japan SR2200 Critical commercial assays SMART-Seq HT Kit Takara Bio, Shiga, Japan Cat# 634456 Nextera® XT DNA Library Prep Kit Illumina, San Diego, CA, USA REF 15032350 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific, Waltham, MA, USA REF Q32852 Deposited data Sequencing data reported in this paper NCBI database PRJNA1256131 Experimental models: Rice plants Oryza sativa This study N/A DD45p::OsBBM1-2 This study N/A DD45p::OsBBM1-7 This study N/A DD45p::OsBBM1-8 This study N/A Oligonucleotides For primer used see Table S1 This study N/A For primer used see Table S7 This study N/A Recombinant DNA Plasmid: DD45p::OsBBM1 This study N/A Software and algorithms BX-73 inverted microscope Olympus, Japan N/A DP73 digital camera Olympus, Japan N/A cellSen® Standard Olympus, Japan N/A Nikon C2 confocal microscope (Ver.450) Nikon NIS-Elements AR, Tokyo, Japan N/A FastQC (v0.11.8) Simon46 https://www.bioinformatics.babraham.ac.uk/projects Cutadapt (v2.10) Martin47 https://doi.org/10.14806/ej.17.1.200 RSEM (v1.3.1) Li and Dewey48 http://www.biomedcentral.com/1471-2105/12/323 Bowtie2 (v 2.3.5.1) Langmead and Salzberg49 https://doi.org/10.1038/nmeth.1923 TCC (Tag Count Comparison) Sun et al.50 http://www.biomedcentral.com/1471-2105/14/219 GO analysis tool (agriGO v2.0) Tian et al.51 https://doi.org/10.1093/nar/gkx382 Other Oc Riken Bio-Resource Center, Tsukuba, Japan N/A e1 iScience 28, 113621, October 17, 2025 ..
Article Title: Isolation and transcriptional profiling of antigen-presenting cells from mouse lung and MLNs following intranasal immunization.
Article Snippet: Wang et al., STAR Protocols 5, 103400 December 20, 2024 a 2024 Dendritic cells (DCs) play a central role in the initiation of the adaptive immune response.. Here, we present a protocol for isolating and transcriptionally profiling antigen-presenting cells (APCs) from the mouse lung andmediastinal lymph nodes (MLNs) following intranasal immunization.. We describe steps for preparing single-cell suspensions from the lung and MLN, along with the detection and RNA sequencing (RNA-seq) of antigen-presenting DCs.
other:Article Title: Seven-year performance of a clinical metagenomic next-generation sequencing test for diagnosis of central nervous system infections
Article Snippet: Nextera XT DNA Library Prep Kit Illumina, San Diego, CA Library preparation AMPure XP beads Beckman Coulter Library preparation Phusion enzyme Thermo Fisher Library preparation Qubit dsDNA HS Assay Kit Thermo Fisher Library preparation High Sensitivity DNA kit Agilent Library preparation
Single Cell:Article Title: Early-life B cell memory is archived in the mouse B-1 cell compartment and drives chronic lymphocytic leukemia-like disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Draq7 BD Biosciences Cat# 564904 Alexa Fluor 488 Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Pacific Blue Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Critical commercial assays Cytofix/Cytoperm Kit BD Biosciences Cat# BDB554714 Mouse Immune Single-Cell Multiplexing Kit BD Biosciences Cat# 633793 AMPure XP Reagent Beckman Coulter Cat# A63880 dsDNA HS Assay Kit Fisher Scientific Cat# 10606433 High Sensitivity DNA Kit Agilent Cat# 5067-4626 S1 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028318 Direct-zol RNA MiniPrep Kit Zymo Research Cat# R2050 SMARTScribe Reverse Transcriptase Takara Bio Cat# 639537 Q5 High-Fidelity DNA Polymerase New England Biolabs Cat# M0491 Nextera XT Index Kit v2 SetA Illumina Cat# 15052163 MiSeq Reagent Kit v3 (600 cycles) Illumina Cat# MS-102-3003 SMART-Seq v4 Ultra Low Input RNA Kit Takara Bio Cat# 634889 Nextera XT DNA library prep Kit Illumina Cat# FC-131-1024 DNA/RNA UD Indexes Set A Illumina Cat# 200027213 S4 Reagent Kit v1.5 (300 cycle XP) Illumina Cat# 20028312 Deposited data Single-cell RNA-Seq data This paper GEO: GSE314339 ATAC-Seq data This paper GEO: GSE309960 Bulk VDJ-Seq data This paper GEO: GSE314340 Bulk RNA-Seq data This paper GEO: GSE314338 Experimental models: Organisms/strains B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ Hobeika et al.76 JAX 033026 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J Madisen et al.77 JAX 007909 Eμ-TCL-1 tg Laboratory of P. Ghia45 NA Oligonucleotides Template Switching Oligonucleotide (TSO) IDT 5′/BiosG/AAGCAGTGGTArUCAA CGCAGAGrUTCAGTGrGrGrG-3′ IgHM Reverse Primer IDT 5′CTGATACCCTGGATGACTTC-3′ TSO Amplification Forward Primer IDT 5′TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGAAGCAGTGGTATC AACGCAGAGT-3′ IgHM Reverse Primer (with Illumina adaptor) IDT 5′GTCTCGTGGGCTCGGAGAT GTGTATAAGAGACAGGGAA GACATTTGGGAAGGACTGACT-3′ Software and algorithms R v4.4.0 R Core Team www.R-project.org Change-O v1.3.0 Immcantation Portal https://changeo.readthedocs.io/en/stable/# pResto v0.7.1 Immcantation Portal https://presto.readthedocs.io/en/stable/ ShazaM v1.2.0 Immcantation Portal https://shazam.readthedocs.io/en/stable/ Seurat v5.1.0 Satija Laboratory https://satijalab.org/seurat/ DESeq2 v1.42.1 and v1.46.0 Bioconductor https://bioconductor.org/packages/release/ bioc/html/DESeq2.html nf-core/rnaseq v3.14 nf-core https://nf-co.re/rnaseq/3.14.0/ (Continued on next page) Cell Reports 45, 117202, April 28, 2026 17 .. Mb1Cre− ERT2 mice (JAX 033026 B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ)76 were crossed to R26fl− STOP-Tom reporter mice (JAX 007909 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J)77 to generate time-stampable mice heterozygous for both alleles.
Multiplexing:Article Title: Early-life B cell memory is archived in the mouse B-1 cell compartment and drives chronic lymphocytic leukemia-like disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Draq7 BD Biosciences Cat# 564904 Alexa Fluor 488 Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Pacific Blue Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Critical commercial assays Cytofix/Cytoperm Kit BD Biosciences Cat# BDB554714 Mouse Immune Single-Cell Multiplexing Kit BD Biosciences Cat# 633793 AMPure XP Reagent Beckman Coulter Cat# A63880 dsDNA HS Assay Kit Fisher Scientific Cat# 10606433 High Sensitivity DNA Kit Agilent Cat# 5067-4626 S1 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028318 Direct-zol RNA MiniPrep Kit Zymo Research Cat# R2050 SMARTScribe Reverse Transcriptase Takara Bio Cat# 639537 Q5 High-Fidelity DNA Polymerase New England Biolabs Cat# M0491 Nextera XT Index Kit v2 SetA Illumina Cat# 15052163 MiSeq Reagent Kit v3 (600 cycles) Illumina Cat# MS-102-3003 SMART-Seq v4 Ultra Low Input RNA Kit Takara Bio Cat# 634889 Nextera XT DNA library prep Kit Illumina Cat# FC-131-1024 DNA/RNA UD Indexes Set A Illumina Cat# 200027213 S4 Reagent Kit v1.5 (300 cycle XP) Illumina Cat# 20028312 Deposited data Single-cell RNA-Seq data This paper GEO: GSE314339 ATAC-Seq data This paper GEO: GSE309960 Bulk VDJ-Seq data This paper GEO: GSE314340 Bulk RNA-Seq data This paper GEO: GSE314338 Experimental models: Organisms/strains B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ Hobeika et al.76 JAX 033026 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J Madisen et al.77 JAX 007909 Eμ-TCL-1 tg Laboratory of P. Ghia45 NA Oligonucleotides Template Switching Oligonucleotide (TSO) IDT 5′/BiosG/AAGCAGTGGTArUCAA CGCAGAGrUTCAGTGrGrGrG-3′ IgHM Reverse Primer IDT 5′CTGATACCCTGGATGACTTC-3′ TSO Amplification Forward Primer IDT 5′TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGAAGCAGTGGTATC AACGCAGAGT-3′ IgHM Reverse Primer (with Illumina adaptor) IDT 5′GTCTCGTGGGCTCGGAGAT GTGTATAAGAGACAGGGAA GACATTTGGGAAGGACTGACT-3′ Software and algorithms R v4.4.0 R Core Team www.R-project.org Change-O v1.3.0 Immcantation Portal https://changeo.readthedocs.io/en/stable/# pResto v0.7.1 Immcantation Portal https://presto.readthedocs.io/en/stable/ ShazaM v1.2.0 Immcantation Portal https://shazam.readthedocs.io/en/stable/ Seurat v5.1.0 Satija Laboratory https://satijalab.org/seurat/ DESeq2 v1.42.1 and v1.46.0 Bioconductor https://bioconductor.org/packages/release/ bioc/html/DESeq2.html nf-core/rnaseq v3.14 nf-core https://nf-co.re/rnaseq/3.14.0/ (Continued on next page) Cell Reports 45, 117202, April 28, 2026 17 .. Mb1Cre− ERT2 mice (JAX 033026 B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ)76 were crossed to R26fl− STOP-Tom reporter mice (JAX 007909 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J)77 to generate time-stampable mice heterozygous for both alleles.
Reverse Transcription:Article Title: Early-life B cell memory is archived in the mouse B-1 cell compartment and drives chronic lymphocytic leukemia-like disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Draq7 BD Biosciences Cat# 564904 Alexa Fluor 488 Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Pacific Blue Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Critical commercial assays Cytofix/Cytoperm Kit BD Biosciences Cat# BDB554714 Mouse Immune Single-Cell Multiplexing Kit BD Biosciences Cat# 633793 AMPure XP Reagent Beckman Coulter Cat# A63880 dsDNA HS Assay Kit Fisher Scientific Cat# 10606433 High Sensitivity DNA Kit Agilent Cat# 5067-4626 S1 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028318 Direct-zol RNA MiniPrep Kit Zymo Research Cat# R2050 SMARTScribe Reverse Transcriptase Takara Bio Cat# 639537 Q5 High-Fidelity DNA Polymerase New England Biolabs Cat# M0491 Nextera XT Index Kit v2 SetA Illumina Cat# 15052163 MiSeq Reagent Kit v3 (600 cycles) Illumina Cat# MS-102-3003 SMART-Seq v4 Ultra Low Input RNA Kit Takara Bio Cat# 634889 Nextera XT DNA library prep Kit Illumina Cat# FC-131-1024 DNA/RNA UD Indexes Set A Illumina Cat# 200027213 S4 Reagent Kit v1.5 (300 cycle XP) Illumina Cat# 20028312 Deposited data Single-cell RNA-Seq data This paper GEO: GSE314339 ATAC-Seq data This paper GEO: GSE309960 Bulk VDJ-Seq data This paper GEO: GSE314340 Bulk RNA-Seq data This paper GEO: GSE314338 Experimental models: Organisms/strains B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ Hobeika et al.76 JAX 033026 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J Madisen et al.77 JAX 007909 Eμ-TCL-1 tg Laboratory of P. Ghia45 NA Oligonucleotides Template Switching Oligonucleotide (TSO) IDT 5′/BiosG/AAGCAGTGGTArUCAA CGCAGAGrUTCAGTGrGrGrG-3′ IgHM Reverse Primer IDT 5′CTGATACCCTGGATGACTTC-3′ TSO Amplification Forward Primer IDT 5′TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGAAGCAGTGGTATC AACGCAGAGT-3′ IgHM Reverse Primer (with Illumina adaptor) IDT 5′GTCTCGTGGGCTCGGAGAT GTGTATAAGAGACAGGGAA GACATTTGGGAAGGACTGACT-3′ Software and algorithms R v4.4.0 R Core Team www.R-project.org Change-O v1.3.0 Immcantation Portal https://changeo.readthedocs.io/en/stable/# pResto v0.7.1 Immcantation Portal https://presto.readthedocs.io/en/stable/ ShazaM v1.2.0 Immcantation Portal https://shazam.readthedocs.io/en/stable/ Seurat v5.1.0 Satija Laboratory https://satijalab.org/seurat/ DESeq2 v1.42.1 and v1.46.0 Bioconductor https://bioconductor.org/packages/release/ bioc/html/DESeq2.html nf-core/rnaseq v3.14 nf-core https://nf-co.re/rnaseq/3.14.0/ (Continued on next page) Cell Reports 45, 117202, April 28, 2026 17 .. Mb1Cre− ERT2 mice (JAX 033026 B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ)76 were crossed to R26fl− STOP-Tom reporter mice (JAX 007909 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J)77 to generate time-stampable mice heterozygous for both alleles.
RNA sequencing:Article Title: Early-life B cell memory is archived in the mouse B-1 cell compartment and drives chronic lymphocytic leukemia-like disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Draq7 BD Biosciences Cat# 564904 Alexa Fluor 488 Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Pacific Blue Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Critical commercial assays Cytofix/Cytoperm Kit BD Biosciences Cat# BDB554714 Mouse Immune Single-Cell Multiplexing Kit BD Biosciences Cat# 633793 AMPure XP Reagent Beckman Coulter Cat# A63880 dsDNA HS Assay Kit Fisher Scientific Cat# 10606433 High Sensitivity DNA Kit Agilent Cat# 5067-4626 S1 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028318 Direct-zol RNA MiniPrep Kit Zymo Research Cat# R2050 SMARTScribe Reverse Transcriptase Takara Bio Cat# 639537 Q5 High-Fidelity DNA Polymerase New England Biolabs Cat# M0491 Nextera XT Index Kit v2 SetA Illumina Cat# 15052163 MiSeq Reagent Kit v3 (600 cycles) Illumina Cat# MS-102-3003 SMART-Seq v4 Ultra Low Input RNA Kit Takara Bio Cat# 634889 Nextera XT DNA library prep Kit Illumina Cat# FC-131-1024 DNA/RNA UD Indexes Set A Illumina Cat# 200027213 S4 Reagent Kit v1.5 (300 cycle XP) Illumina Cat# 20028312 Deposited data Single-cell RNA-Seq data This paper GEO: GSE314339 ATAC-Seq data This paper GEO: GSE309960 Bulk VDJ-Seq data This paper GEO: GSE314340 Bulk RNA-Seq data This paper GEO: GSE314338 Experimental models: Organisms/strains B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ Hobeika et al.76 JAX 033026 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J Madisen et al.77 JAX 007909 Eμ-TCL-1 tg Laboratory of P. Ghia45 NA Oligonucleotides Template Switching Oligonucleotide (TSO) IDT 5′/BiosG/AAGCAGTGGTArUCAA CGCAGAGrUTCAGTGrGrGrG-3′ IgHM Reverse Primer IDT 5′CTGATACCCTGGATGACTTC-3′ TSO Amplification Forward Primer IDT 5′TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGAAGCAGTGGTATC AACGCAGAGT-3′ IgHM Reverse Primer (with Illumina adaptor) IDT 5′GTCTCGTGGGCTCGGAGAT GTGTATAAGAGACAGGGAA GACATTTGGGAAGGACTGACT-3′ Software and algorithms R v4.4.0 R Core Team www.R-project.org Change-O v1.3.0 Immcantation Portal https://changeo.readthedocs.io/en/stable/# pResto v0.7.1 Immcantation Portal https://presto.readthedocs.io/en/stable/ ShazaM v1.2.0 Immcantation Portal https://shazam.readthedocs.io/en/stable/ Seurat v5.1.0 Satija Laboratory https://satijalab.org/seurat/ DESeq2 v1.42.1 and v1.46.0 Bioconductor https://bioconductor.org/packages/release/ bioc/html/DESeq2.html nf-core/rnaseq v3.14 nf-core https://nf-co.re/rnaseq/3.14.0/ (Continued on next page) Cell Reports 45, 117202, April 28, 2026 17 .. Mb1Cre− ERT2 mice (JAX 033026 B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ)76 were crossed to R26fl− STOP-Tom reporter mice (JAX 007909 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J)77 to generate time-stampable mice heterozygous for both alleles.
Amplification:Article Title: Early-life B cell memory is archived in the mouse B-1 cell compartment and drives chronic lymphocytic leukemia-like disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Draq7 BD Biosciences Cat# 564904 Alexa Fluor 488 Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Pacific Blue Lancefield group A carbohydrate (GAC) Laboratories of J.F.Kearney and R.G.King9 NA Critical commercial assays Cytofix/Cytoperm Kit BD Biosciences Cat# BDB554714 Mouse Immune Single-Cell Multiplexing Kit BD Biosciences Cat# 633793 AMPure XP Reagent Beckman Coulter Cat# A63880 dsDNA HS Assay Kit Fisher Scientific Cat# 10606433 High Sensitivity DNA Kit Agilent Cat# 5067-4626 S1 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028318 Direct-zol RNA MiniPrep Kit Zymo Research Cat# R2050 SMARTScribe Reverse Transcriptase Takara Bio Cat# 639537 Q5 High-Fidelity DNA Polymerase New England Biolabs Cat# M0491 Nextera XT Index Kit v2 SetA Illumina Cat# 15052163 MiSeq Reagent Kit v3 (600 cycles) Illumina Cat# MS-102-3003 SMART-Seq v4 Ultra Low Input RNA Kit Takara Bio Cat# 634889 Nextera XT DNA library prep Kit Illumina Cat# FC-131-1024 DNA/RNA UD Indexes Set A Illumina Cat# 200027213 S4 Reagent Kit v1.5 (300 cycle XP) Illumina Cat# 20028312 Deposited data Single-cell RNA-Seq data This paper GEO: GSE314339 ATAC-Seq data This paper GEO: GSE309960 Bulk VDJ-Seq data This paper GEO: GSE314340 Bulk RNA-Seq data This paper GEO: GSE314338 Experimental models: Organisms/strains B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ Hobeika et al.76 JAX 033026 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J Madisen et al.77 JAX 007909 Eμ-TCL-1 tg Laboratory of P. Ghia45 NA Oligonucleotides Template Switching Oligonucleotide (TSO) IDT 5′/BiosG/AAGCAGTGGTArUCAA CGCAGAGrUTCAGTGrGrGrG-3′ IgHM Reverse Primer IDT 5′CTGATACCCTGGATGACTTC-3′ TSO Amplification Forward Primer IDT 5′TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGAAGCAGTGGTATC AACGCAGAGT-3′ IgHM Reverse Primer (with Illumina adaptor) IDT 5′GTCTCGTGGGCTCGGAGAT GTGTATAAGAGACAGGGAA GACATTTGGGAAGGACTGACT-3′ Software and algorithms R v4.4.0 R Core Team www.R-project.org Change-O v1.3.0 Immcantation Portal https://changeo.readthedocs.io/en/stable/# pResto v0.7.1 Immcantation Portal https://presto.readthedocs.io/en/stable/ ShazaM v1.2.0 Immcantation Portal https://shazam.readthedocs.io/en/stable/ Seurat v5.1.0 Satija Laboratory https://satijalab.org/seurat/ DESeq2 v1.42.1 and v1.46.0 Bioconductor https://bioconductor.org/packages/release/ bioc/html/DESeq2.html nf-core/rnaseq v3.14 nf-core https://nf-co.re/rnaseq/3.14.0/ (Continued on next page) Cell Reports 45, 117202, April 28, 2026 17 .. Mb1Cre− ERT2 mice (JAX 033026 B6.C-Cd79atm3(cre/ERT2)Reth/EhobJ)76 were crossed to R26fl− STOP-Tom reporter mice (JAX 007909 B6.Cg-Gt(ROSA)26Sortm9(CA-tdTomato)Hze/J)77 to generate time-stampable mice heterozygous for both alleles.
Real-time Polymerase Chain Reaction:Article Title: Physical and functional interaction among Irf8 enhancers during dendritic cell differentiation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotin-conjugated Armenian Hamster Anti-Mouse CD3ε (clone 145-2C11) BioLegend Cat# 100304 Biotin-conjugated Rat Anti-Mouse F4/80 (clone BM8) BioLegend Cat# 123106 Biotin-conjugated Rat Anti-mouse IL-7R (clone A7R34) BioLegend Cat# 135006 Biotin-conjugated Rat Anti-mouse Ly-6G (clone 1A8) BioLegend Cat# 127604 Biotin-conjugated Mouse Anti-Mouse NK1.1 (clone PK136) BD Biosciences Cat# 553163 Biotin-conjugated Rat Anti-Mouse Ter119 (clone TER-119) BioLegend Cat# 116204 Purified Rat anti-mouse CD16/32 (clone 93) BioLegend Cat# 101302 Rabbit Polyclonal Anti-Mouse Histone H3 (acetyl K27) Antibody Abcam Cat# ab4729 Guinea Pig Polyclonal Anti-Rabbit IgG (Heavy & Light Chain) Antibody Antibodies online Cat# ABIN101961 Acetyl-Histone H3 (Lys27) (D5E4) XP Rabbit mAb (PE Conjugate) Cell Signaling Cat# 15562S Rabbit (DA1E) mAb IgG XP Isotype Control (PE Conjugate) Cell Signaling Cat# 5742S Bacterial and virus strains MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A Chemicals, peptides, and recombinant proteins Liberase DL Roche Cat# 5466202001 DNase I, grade II, Roche Cat# 10104159001 Recombinant Murine SCF PeproTech Cat# 250-03 Recombinant Murine IL-3 PeproTech Cat# 213-13 Recombinant Murine IL-6 PeproTech Cat# 216-16 Recombinant Human Flt3-Ligand PeproTech Cat# 300-19 RPMI1640 Nacalai Tesque Cat# 30263-95 Fetal Bovine Serum (Lot# 0001641431) Sigma Cat# 173012 D-MEM FUJIFILM Wako Pure Chemical Cat# 043-30085 PEI MAX Polysciences Cat# 24765-1 Dpn II NEB Cat# R0543M Biotin-14-dATP Thermo Fisher Scientific Cat# 19524016 DNA Polymerase I, Large (Klenow) Fragment NEB Cat# M0210L T4 DNA Ligase NEB Cat# M0202M Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 KOD FX Neo polymerase Toyobo Cat# KFX-201 Agarose ME Iwai Chemicals Cat# 50013R Agarose H Nippon gene Cat# 319-01201 Marker 7 GT Nippon gene Cat# 315-03981 Atlas Clear Sight Gold DNA Stain solution BioAtlas Cat# BH40701 Blocking One-P Nacalai Tesque Cat# 05999-84 (Continued on next page) 14 Cell Reports 43, 114107, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Lineage Cell Depletion Kit, mouse Miltenyi Biotec Cat# 130-110-470 CD8+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-169 CD4+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-262 RNeasy Micro Kit Qiagen Cat# 74004 SMART-Seq HT Kit Takara Bio Cat# 634437 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1096 KAPA HyperPrep Kits Roche Cat# 07962347001 SureSelect XT HS Reagents Agilent Technologies Cat# G9702A SureSelect PostPool Custom Tier2 Agilent Technologies Cat# 5191-6905 PrimeScript RT Reagent kit Takara Bio Cat# RR037B THUNDERBIRD SYBR qPCR Mix Toyobo Cat# QPS-201 Deposited data RNA-seq data for wild-type CDPs, cDC1s and cDC2s Murakami et al.8 GEO: GSE149762 RNA-seq data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 ATAC-seq data for wild-type MDPs and CDPs Murakami et al.8 GEO: GSE149762 ATAC-seq data for wild-type cDC1s Brown et al.43 GEO: GSE130201 ChIP-seq data for wild-type LMPPs and MDPs Murakami et al.8 GEO: GSE149762 Tiled-C data This study DDBJ: DRA016834 H3K27ac CUT&Tag data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 Experimental models: Cell lines 293TN cell line System Biosciences Cat# LV900A-1 Experimental models: Organisms/strains Mouse: C57BL/6 Japan SLC C57BL/6JJmsSlc Mouse: Irf8 / : Irf8tm1Hor Holtschke et al.44 N/A Mouse: +32D/D Murakami et al.8 N/A Mouse: +56D/D Murakami et al.8 N/A Mouse: +32WT/D This study N/A Mouse: +56D/WT This study N/A Mouse: +56D/WT+32WT/D This study N/A Oligonucleotides Oligonucleotides used in this study, see Table S1 This study N/A Recombinant DNA MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A pCL-Eco Naviaux et al.45 N/A Software and algorithms FlowJo (version 10.8.1) BD Life Sciences Cat# 663335 STAR (version 2.7.7a) Dobin et al.46 https://github.com/alexdobin/STAR Picard (version 2.25.0) Broad Institute http://broadinstitute.github.io/picard/ RSEM (version 1.3.3) Li et al.47 https://github.com/deweylab/RSEM R (version 4.0.3) The R Foundation for Statistical Computing https://www.r-project.org/ (Continued on next page) Cell Reports 43, 114107, April 23, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER edgeR (version 3.32.1) Robinson et al.48 https://bioconductor.org/packages/ release/bioc/html/edgeR.html R Stats (version 4.3) R Core Team https://stat.ethz.ch/R-manual/R-devel/ library/stats/html/00Index.html ggplot2 (version 3.2.4) Hadley Wickham, https://ggplot2.tidyverse.org/ authors.html#citation https://ggplot2.tidyverse.org/ Bowtie2 (version 2.3.5.1) Langmead et al.49 https://bowtie-bio.sourceforge.net/ bowtie2/index.shtml HOMER (version 4.11) Heinz et al.50 http://homer.ucsd.edu/homer/index.html GOPHER (version 0.6.0) Hansen et al.51 https://github.com/TheJacksonLaboratory/Gopher Agilent SureDesign tool Agilent Technologies https://earray.chem.agilent.com/suredesign/ Hi-Cpro (version 3.0.0) Servant et al.52 https://github.com/nservant/HiC-Pro Treeview3 (version 3.0 Beta 1) Christopher Keil, https://doi.org/10.5281/ zenodo.1303402 https://bitbucket.org/TreeView3Dev/ treeview3/src/master/ GraphPad Prism 9 GraphPad https://www.graphpad.com GSEA software (version 4.0.3) Broad Institute53 https://www.gsea-msigdb.org/gsea/index.jsp
In Vitro:Article Title: Physical and functional interaction among Irf8 enhancers during dendritic cell differentiation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotin-conjugated Armenian Hamster Anti-Mouse CD3ε (clone 145-2C11) BioLegend Cat# 100304 Biotin-conjugated Rat Anti-Mouse F4/80 (clone BM8) BioLegend Cat# 123106 Biotin-conjugated Rat Anti-mouse IL-7R (clone A7R34) BioLegend Cat# 135006 Biotin-conjugated Rat Anti-mouse Ly-6G (clone 1A8) BioLegend Cat# 127604 Biotin-conjugated Mouse Anti-Mouse NK1.1 (clone PK136) BD Biosciences Cat# 553163 Biotin-conjugated Rat Anti-Mouse Ter119 (clone TER-119) BioLegend Cat# 116204 Purified Rat anti-mouse CD16/32 (clone 93) BioLegend Cat# 101302 Rabbit Polyclonal Anti-Mouse Histone H3 (acetyl K27) Antibody Abcam Cat# ab4729 Guinea Pig Polyclonal Anti-Rabbit IgG (Heavy & Light Chain) Antibody Antibodies online Cat# ABIN101961 Acetyl-Histone H3 (Lys27) (D5E4) XP Rabbit mAb (PE Conjugate) Cell Signaling Cat# 15562S Rabbit (DA1E) mAb IgG XP Isotype Control (PE Conjugate) Cell Signaling Cat# 5742S Bacterial and virus strains MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A Chemicals, peptides, and recombinant proteins Liberase DL Roche Cat# 5466202001 DNase I, grade II, Roche Cat# 10104159001 Recombinant Murine SCF PeproTech Cat# 250-03 Recombinant Murine IL-3 PeproTech Cat# 213-13 Recombinant Murine IL-6 PeproTech Cat# 216-16 Recombinant Human Flt3-Ligand PeproTech Cat# 300-19 RPMI1640 Nacalai Tesque Cat# 30263-95 Fetal Bovine Serum (Lot# 0001641431) Sigma Cat# 173012 D-MEM FUJIFILM Wako Pure Chemical Cat# 043-30085 PEI MAX Polysciences Cat# 24765-1 Dpn II NEB Cat# R0543M Biotin-14-dATP Thermo Fisher Scientific Cat# 19524016 DNA Polymerase I, Large (Klenow) Fragment NEB Cat# M0210L T4 DNA Ligase NEB Cat# M0202M Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 KOD FX Neo polymerase Toyobo Cat# KFX-201 Agarose ME Iwai Chemicals Cat# 50013R Agarose H Nippon gene Cat# 319-01201 Marker 7 GT Nippon gene Cat# 315-03981 Atlas Clear Sight Gold DNA Stain solution BioAtlas Cat# BH40701 Blocking One-P Nacalai Tesque Cat# 05999-84 (Continued on next page) 14 Cell Reports 43, 114107, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Lineage Cell Depletion Kit, mouse Miltenyi Biotec Cat# 130-110-470 CD8+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-169 CD4+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-262 RNeasy Micro Kit Qiagen Cat# 74004 SMART-Seq HT Kit Takara Bio Cat# 634437 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1096 KAPA HyperPrep Kits Roche Cat# 07962347001 SureSelect XT HS Reagents Agilent Technologies Cat# G9702A SureSelect PostPool Custom Tier2 Agilent Technologies Cat# 5191-6905 PrimeScript RT Reagent kit Takara Bio Cat# RR037B THUNDERBIRD SYBR qPCR Mix Toyobo Cat# QPS-201 Deposited data RNA-seq data for wild-type CDPs, cDC1s and cDC2s Murakami et al.8 GEO: GSE149762 RNA-seq data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 ATAC-seq data for wild-type MDPs and CDPs Murakami et al.8 GEO: GSE149762 ATAC-seq data for wild-type cDC1s Brown et al.43 GEO: GSE130201 ChIP-seq data for wild-type LMPPs and MDPs Murakami et al.8 GEO: GSE149762 Tiled-C data This study DDBJ: DRA016834 H3K27ac CUT&Tag data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 Experimental models: Cell lines 293TN cell line System Biosciences Cat# LV900A-1 Experimental models: Organisms/strains Mouse: C57BL/6 Japan SLC C57BL/6JJmsSlc Mouse: Irf8 / : Irf8tm1Hor Holtschke et al.44 N/A Mouse: +32D/D Murakami et al.8 N/A Mouse: +56D/D Murakami et al.8 N/A Mouse: +32WT/D This study N/A Mouse: +56D/WT This study N/A Mouse: +56D/WT+32WT/D This study N/A Oligonucleotides Oligonucleotides used in this study, see Table S1 This study N/A Recombinant DNA MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A pCL-Eco Naviaux et al.45 N/A Software and algorithms FlowJo (version 10.8.1) BD Life Sciences Cat# 663335 STAR (version 2.7.7a) Dobin et al.46 https://github.com/alexdobin/STAR Picard (version 2.25.0) Broad Institute http://broadinstitute.github.io/picard/ RSEM (version 1.3.3) Li et al.47 https://github.com/deweylab/RSEM R (version 4.0.3) The R Foundation for Statistical Computing https://www.r-project.org/ (Continued on next page) Cell Reports 43, 114107, April 23, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER edgeR (version 3.32.1) Robinson et al.48 https://bioconductor.org/packages/ release/bioc/html/edgeR.html R Stats (version 4.3) R Core Team https://stat.ethz.ch/R-manual/R-devel/ library/stats/html/00Index.html ggplot2 (version 3.2.4) Hadley Wickham, https://ggplot2.tidyverse.org/ authors.html#citation https://ggplot2.tidyverse.org/ Bowtie2 (version 2.3.5.1) Langmead et al.49 https://bowtie-bio.sourceforge.net/ bowtie2/index.shtml HOMER (version 4.11) Heinz et al.50 http://homer.ucsd.edu/homer/index.html GOPHER (version 0.6.0) Hansen et al.51 https://github.com/TheJacksonLaboratory/Gopher Agilent SureDesign tool Agilent Technologies https://earray.chem.agilent.com/suredesign/ Hi-Cpro (version 3.0.0) Servant et al.52 https://github.com/nservant/HiC-Pro Treeview3 (version 3.0 Beta 1) Christopher Keil, https://doi.org/10.5281/ zenodo.1303402 https://bitbucket.org/TreeView3Dev/ treeview3/src/master/ GraphPad Prism 9 GraphPad https://www.graphpad.com GSEA software (version 4.0.3) Broad Institute53 https://www.gsea-msigdb.org/gsea/index.jsp
Chromatin Immunoprecipitation:Article Title: Physical and functional interaction among Irf8 enhancers during dendritic cell differentiation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotin-conjugated Armenian Hamster Anti-Mouse CD3ε (clone 145-2C11) BioLegend Cat# 100304 Biotin-conjugated Rat Anti-Mouse F4/80 (clone BM8) BioLegend Cat# 123106 Biotin-conjugated Rat Anti-mouse IL-7R (clone A7R34) BioLegend Cat# 135006 Biotin-conjugated Rat Anti-mouse Ly-6G (clone 1A8) BioLegend Cat# 127604 Biotin-conjugated Mouse Anti-Mouse NK1.1 (clone PK136) BD Biosciences Cat# 553163 Biotin-conjugated Rat Anti-Mouse Ter119 (clone TER-119) BioLegend Cat# 116204 Purified Rat anti-mouse CD16/32 (clone 93) BioLegend Cat# 101302 Rabbit Polyclonal Anti-Mouse Histone H3 (acetyl K27) Antibody Abcam Cat# ab4729 Guinea Pig Polyclonal Anti-Rabbit IgG (Heavy & Light Chain) Antibody Antibodies online Cat# ABIN101961 Acetyl-Histone H3 (Lys27) (D5E4) XP Rabbit mAb (PE Conjugate) Cell Signaling Cat# 15562S Rabbit (DA1E) mAb IgG XP Isotype Control (PE Conjugate) Cell Signaling Cat# 5742S Bacterial and virus strains MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A Chemicals, peptides, and recombinant proteins Liberase DL Roche Cat# 5466202001 DNase I, grade II, Roche Cat# 10104159001 Recombinant Murine SCF PeproTech Cat# 250-03 Recombinant Murine IL-3 PeproTech Cat# 213-13 Recombinant Murine IL-6 PeproTech Cat# 216-16 Recombinant Human Flt3-Ligand PeproTech Cat# 300-19 RPMI1640 Nacalai Tesque Cat# 30263-95 Fetal Bovine Serum (Lot# 0001641431) Sigma Cat# 173012 D-MEM FUJIFILM Wako Pure Chemical Cat# 043-30085 PEI MAX Polysciences Cat# 24765-1 Dpn II NEB Cat# R0543M Biotin-14-dATP Thermo Fisher Scientific Cat# 19524016 DNA Polymerase I, Large (Klenow) Fragment NEB Cat# M0210L T4 DNA Ligase NEB Cat# M0202M Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 KOD FX Neo polymerase Toyobo Cat# KFX-201 Agarose ME Iwai Chemicals Cat# 50013R Agarose H Nippon gene Cat# 319-01201 Marker 7 GT Nippon gene Cat# 315-03981 Atlas Clear Sight Gold DNA Stain solution BioAtlas Cat# BH40701 Blocking One-P Nacalai Tesque Cat# 05999-84 (Continued on next page) 14 Cell Reports 43, 114107, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Lineage Cell Depletion Kit, mouse Miltenyi Biotec Cat# 130-110-470 CD8+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-169 CD4+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-262 RNeasy Micro Kit Qiagen Cat# 74004 SMART-Seq HT Kit Takara Bio Cat# 634437 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1096 KAPA HyperPrep Kits Roche Cat# 07962347001 SureSelect XT HS Reagents Agilent Technologies Cat# G9702A SureSelect PostPool Custom Tier2 Agilent Technologies Cat# 5191-6905 PrimeScript RT Reagent kit Takara Bio Cat# RR037B THUNDERBIRD SYBR qPCR Mix Toyobo Cat# QPS-201 Deposited data RNA-seq data for wild-type CDPs, cDC1s and cDC2s Murakami et al.8 GEO: GSE149762 RNA-seq data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 ATAC-seq data for wild-type MDPs and CDPs Murakami et al.8 GEO: GSE149762 ATAC-seq data for wild-type cDC1s Brown et al.43 GEO: GSE130201 ChIP-seq data for wild-type LMPPs and MDPs Murakami et al.8 GEO: GSE149762 Tiled-C data This study DDBJ: DRA016834 H3K27ac CUT&Tag data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 Experimental models: Cell lines 293TN cell line System Biosciences Cat# LV900A-1 Experimental models: Organisms/strains Mouse: C57BL/6 Japan SLC C57BL/6JJmsSlc Mouse: Irf8 / : Irf8tm1Hor Holtschke et al.44 N/A Mouse: +32D/D Murakami et al.8 N/A Mouse: +56D/D Murakami et al.8 N/A Mouse: +32WT/D This study N/A Mouse: +56D/WT This study N/A Mouse: +56D/WT+32WT/D This study N/A Oligonucleotides Oligonucleotides used in this study, see Table S1 This study N/A Recombinant DNA MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A pCL-Eco Naviaux et al.45 N/A Software and algorithms FlowJo (version 10.8.1) BD Life Sciences Cat# 663335 STAR (version 2.7.7a) Dobin et al.46 https://github.com/alexdobin/STAR Picard (version 2.25.0) Broad Institute http://broadinstitute.github.io/picard/ RSEM (version 1.3.3) Li et al.47 https://github.com/deweylab/RSEM R (version 4.0.3) The R Foundation for Statistical Computing https://www.r-project.org/ (Continued on next page) Cell Reports 43, 114107, April 23, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER edgeR (version 3.32.1) Robinson et al.48 https://bioconductor.org/packages/ release/bioc/html/edgeR.html R Stats (version 4.3) R Core Team https://stat.ethz.ch/R-manual/R-devel/ library/stats/html/00Index.html ggplot2 (version 3.2.4) Hadley Wickham, https://ggplot2.tidyverse.org/ authors.html#citation https://ggplot2.tidyverse.org/ Bowtie2 (version 2.3.5.1) Langmead et al.49 https://bowtie-bio.sourceforge.net/ bowtie2/index.shtml HOMER (version 4.11) Heinz et al.50 http://homer.ucsd.edu/homer/index.html GOPHER (version 0.6.0) Hansen et al.51 https://github.com/TheJacksonLaboratory/Gopher Agilent SureDesign tool Agilent Technologies https://earray.chem.agilent.com/suredesign/ Hi-Cpro (version 3.0.0) Servant et al.52 https://github.com/nservant/HiC-Pro Treeview3 (version 3.0 Beta 1) Christopher Keil, https://doi.org/10.5281/ zenodo.1303402 https://bitbucket.org/TreeView3Dev/ treeview3/src/master/ GraphPad Prism 9 GraphPad https://www.graphpad.com GSEA software (version 4.0.3) Broad Institute53 https://www.gsea-msigdb.org/gsea/index.jsp
Recombinant:Article Title: Physical and functional interaction among Irf8 enhancers during dendritic cell differentiation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotin-conjugated Armenian Hamster Anti-Mouse CD3ε (clone 145-2C11) BioLegend Cat# 100304 Biotin-conjugated Rat Anti-Mouse F4/80 (clone BM8) BioLegend Cat# 123106 Biotin-conjugated Rat Anti-mouse IL-7R (clone A7R34) BioLegend Cat# 135006 Biotin-conjugated Rat Anti-mouse Ly-6G (clone 1A8) BioLegend Cat# 127604 Biotin-conjugated Mouse Anti-Mouse NK1.1 (clone PK136) BD Biosciences Cat# 553163 Biotin-conjugated Rat Anti-Mouse Ter119 (clone TER-119) BioLegend Cat# 116204 Purified Rat anti-mouse CD16/32 (clone 93) BioLegend Cat# 101302 Rabbit Polyclonal Anti-Mouse Histone H3 (acetyl K27) Antibody Abcam Cat# ab4729 Guinea Pig Polyclonal Anti-Rabbit IgG (Heavy & Light Chain) Antibody Antibodies online Cat# ABIN101961 Acetyl-Histone H3 (Lys27) (D5E4) XP Rabbit mAb (PE Conjugate) Cell Signaling Cat# 15562S Rabbit (DA1E) mAb IgG XP Isotype Control (PE Conjugate) Cell Signaling Cat# 5742S Bacterial and virus strains MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A Chemicals, peptides, and recombinant proteins Liberase DL Roche Cat# 5466202001 DNase I, grade II, Roche Cat# 10104159001 Recombinant Murine SCF PeproTech Cat# 250-03 Recombinant Murine IL-3 PeproTech Cat# 213-13 Recombinant Murine IL-6 PeproTech Cat# 216-16 Recombinant Human Flt3-Ligand PeproTech Cat# 300-19 RPMI1640 Nacalai Tesque Cat# 30263-95 Fetal Bovine Serum (Lot# 0001641431) Sigma Cat# 173012 D-MEM FUJIFILM Wako Pure Chemical Cat# 043-30085 PEI MAX Polysciences Cat# 24765-1 Dpn II NEB Cat# R0543M Biotin-14-dATP Thermo Fisher Scientific Cat# 19524016 DNA Polymerase I, Large (Klenow) Fragment NEB Cat# M0210L T4 DNA Ligase NEB Cat# M0202M Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 KOD FX Neo polymerase Toyobo Cat# KFX-201 Agarose ME Iwai Chemicals Cat# 50013R Agarose H Nippon gene Cat# 319-01201 Marker 7 GT Nippon gene Cat# 315-03981 Atlas Clear Sight Gold DNA Stain solution BioAtlas Cat# BH40701 Blocking One-P Nacalai Tesque Cat# 05999-84 (Continued on next page) 14 Cell Reports 43, 114107, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Lineage Cell Depletion Kit, mouse Miltenyi Biotec Cat# 130-110-470 CD8+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-169 CD4+ Dendritic Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-262 RNeasy Micro Kit Qiagen Cat# 74004 SMART-Seq HT Kit Takara Bio Cat# 634437 Nextera XT DNA Library Prep Kit Illumina Cat# FC-131-1096 KAPA HyperPrep Kits Roche Cat# 07962347001 SureSelect XT HS Reagents Agilent Technologies Cat# G9702A SureSelect PostPool Custom Tier2 Agilent Technologies Cat# 5191-6905 PrimeScript RT Reagent kit Takara Bio Cat# RR037B THUNDERBIRD SYBR qPCR Mix Toyobo Cat# QPS-201 Deposited data RNA-seq data for wild-type CDPs, cDC1s and cDC2s Murakami et al.8 GEO: GSE149762 RNA-seq data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 ATAC-seq data for wild-type MDPs and CDPs Murakami et al.8 GEO: GSE149762 ATAC-seq data for wild-type cDC1s Brown et al.43 GEO: GSE130201 ChIP-seq data for wild-type LMPPs and MDPs Murakami et al.8 GEO: GSE149762 Tiled-C data This study DDBJ: DRA016834 H3K27ac CUT&Tag data for progenitors and cDCs from mice and in vitro culture This study GEO: GSE239952 Experimental models: Cell lines 293TN cell line System Biosciences Cat# LV900A-1 Experimental models: Organisms/strains Mouse: C57BL/6 Japan SLC C57BL/6JJmsSlc Mouse: Irf8 / : Irf8tm1Hor Holtschke et al.44 N/A Mouse: +32D/D Murakami et al.8 N/A Mouse: +56D/D Murakami et al.8 N/A Mouse: +32WT/D This study N/A Mouse: +56D/WT This study N/A Mouse: +56D/WT+32WT/D This study N/A Oligonucleotides Oligonucleotides used in this study, see Table S1 This study N/A Recombinant DNA MSCV-EGFP DeKoter et al.41 N/A MSCV-IRF8-EGFP Tsujimura et al.42 N/A pCL-Eco Naviaux et al.45 N/A Software and algorithms FlowJo (version 10.8.1) BD Life Sciences Cat# 663335 STAR (version 2.7.7a) Dobin et al.46 https://github.com/alexdobin/STAR Picard (version 2.25.0) Broad Institute http://broadinstitute.github.io/picard/ RSEM (version 1.3.3) Li et al.47 https://github.com/deweylab/RSEM R (version 4.0.3) The R Foundation for Statistical Computing https://www.r-project.org/ (Continued on next page) Cell Reports 43, 114107, April 23, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER edgeR (version 3.32.1) Robinson et al.48 https://bioconductor.org/packages/ release/bioc/html/edgeR.html R Stats (version 4.3) R Core Team https://stat.ethz.ch/R-manual/R-devel/ library/stats/html/00Index.html ggplot2 (version 3.2.4) Hadley Wickham, https://ggplot2.tidyverse.org/ authors.html#citation https://ggplot2.tidyverse.org/ Bowtie2 (version 2.3.5.1) Langmead et al.49 https://bowtie-bio.sourceforge.net/ bowtie2/index.shtml HOMER (version 4.11) Heinz et al.50 http://homer.ucsd.edu/homer/index.html GOPHER (version 0.6.0) Hansen et al.51 https://github.com/TheJacksonLaboratory/Gopher Agilent SureDesign tool Agilent Technologies https://earray.chem.agilent.com/suredesign/ Hi-Cpro (version 3.0.0) Servant et al.52 https://github.com/nservant/HiC-Pro Treeview3 (version 3.0 Beta 1) Christopher Keil, https://doi.org/10.5281/ zenodo.1303402 https://bitbucket.org/TreeView3Dev/ treeview3/src/master/ GraphPad Prism 9 GraphPad https://www.graphpad.com GSEA software (version 4.0.3) Broad Institute53 https://www.gsea-msigdb.org/gsea/index.jsp
Article Title: Oryza sativa Baby Boom1 converts the developmental fate of rice egg cells from gametic into somatic status
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples WT egg cells This study N/A DD45p::OsBBM1 egg cells This study N/A Chemicals, peptides, and recombinant proteins PrepManTM Ultra Sample Preparation Reagent Thermo Fisher Scientific, Warrington, UK REF 4318930 Agencourt AMPure XP beads Beckman Coulter, Brea, CA, USA Cat# NC9933872 SCRI Renaissance Stain 2200 Renaissance chemical, Japan SR2200 Critical commercial assays SMART-Seq HT Kit Takara Bio, Shiga, Japan Cat# 634456 Nextera® XT DNA Library Prep Kit Illumina, San Diego, CA, USA REF 15032350 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific, Waltham, MA, USA REF Q32852 Deposited data Sequencing data reported in this paper NCBI database PRJNA1256131 Experimental models: Rice plants Oryza sativa This study N/A DD45p::OsBBM1-2 This study N/A DD45p::OsBBM1-7 This study N/A DD45p::OsBBM1-8 This study N/A Oligonucleotides For primer used see Table S1 This study N/A For primer used see Table S7 This study N/A Recombinant DNA Plasmid: DD45p::OsBBM1 This study N/A Software and algorithms BX-73 inverted microscope Olympus, Japan N/A DP73 digital camera Olympus, Japan N/A cellSen® Standard Olympus, Japan N/A Nikon C2 confocal microscope (Ver.450) Nikon NIS-Elements AR, Tokyo, Japan N/A FastQC (v0.11.8) Simon46 https://www.bioinformatics.babraham.ac.uk/projects Cutadapt (v2.10) Martin47 https://doi.org/10.14806/ej.17.1.200 RSEM (v1.3.1) Li and Dewey48 http://www.biomedcentral.com/1471-2105/12/323 Bowtie2 (v 2.3.5.1) Langmead and Salzberg49 https://doi.org/10.1038/nmeth.1923 TCC (Tag Count Comparison) Sun et al.50 http://www.biomedcentral.com/1471-2105/14/219 GO analysis tool (agriGO v2.0) Tian et al.51 https://doi.org/10.1093/nar/gkx382 Other Oc Riken Bio-Resource Center, Tsukuba, Japan N/A e1 iScience 28, 113621, October 17, 2025 ..
Article Title: Isolation and transcriptional profiling of antigen-presenting cells from mouse lung and MLNs following intranasal immunization.
Article Snippet: Wang et al., STAR Protocols 5, 103400 December 20, 2024 a 2024 Dendritic cells (DCs) play a central role in the initiation of the adaptive immune response.. Here, we present a protocol for isolating and transcriptionally profiling antigen-presenting cells (APCs) from the mouse lung andmediastinal lymph nodes (MLNs) following intranasal immunization.. We describe steps for preparing single-cell suspensions from the lung and MLN, along with the detection and RNA sequencing (RNA-seq) of antigen-presenting DCs.
Article Title: Molecular underpinnings and environmental drivers of loss of heterozygosity in Drosophila intestinal stem cells.
Article Snippet: .. Cell Reports 42, 113485, December 26, 2023 13 Article ll OPEN ACCESS STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Delta ECD (1:1000) DSHB Cat# c594.9b, RRID: AB_528194 Mouse anti-Prospero (1:1000) DSHB Cat# Prospero (MR1A-c) RRID: AB_528440 Chicken anti-GFP (1:2000) Invitrogen Cat# A10262 RRID: AB_2534023 Rabbit anti-Histone H2AvD pS137 (1:1000) Rockland Cat# 600-401-914 RRID: AB_828383 Rabbit anti-PH3 (1:2000) Millipore Cat# 06–570 RRID: AB_310177 Chemicals, peptides, and recombinant proteins RNAscope probes – Pif1 ACD bioteche NM_001298658.1 RNAscope probes – SpnA ACD bioteche NM_079844.4 Critical commercial assays QIAquick PCR Purification Kit Qiagen Cat# 28104 QIAmp DNA Micro Kit Qiagen Cat# 56304 RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Cat#323100 Nextera XT DNA Library Prep Kit Illumina Cat# FC-121-1030 KAPA HyperPlus Kit ROCHE Cat#07962380001 KAPA Library Quanitification Kits ROCHE Cat#07960140001 Deposited data NCBI BioProject database NCBI: PRJNA858414 https://www.ncbi.nlm.nih.gov/bioproject/ Experimental models: Organisms/strains Drosophila: UAS-GFPnls Bloomington Drosophila Stock Center RRID:BDSC_4776 Drosophila: SpnA093 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: SpnA057 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: w[1118] M. McVey N/A Drosophila: Gen[z4325] J. Sekelsky (Andersen, 2011)95 N/A Drosophila: mus81[nhe1] J. Sekelsky (Trowbridge, 2007)96 N/A Drosophila: prosvoila-GAL4 J. .. De Navascués (Balakireva, 1998)97 N/A Drosophila: Su(H)D47 F. Schweisguth RRID:BDSC_51215 Drosophila: UAS-DAP B. Edgar (Reis, 2004)65 N/A Drosophila: UAS-CycE,UAS-stg B. Edgar (Kohlmaier, 2015)66 N/A Drosophila: tubGAL80ts Dl-GAL4 B. Edgar (Zeng, 2010)98 N/A Drosophila: Rad51 (spnA)RNAi VDRC #13362 Drosophila: Pif1RNAi VDRC #34533 Drosophila: engrailed-GAL4 UAS-GFP Y. Bellaiche N/A Pseudomonas entomophila B. Lemaitre (Jiang et al., 2009)43 N/A (Continued on next page) 14 Cell Reports 42, 113485, December 26, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Erwinia carotovora carotovora 15 (Ecc15) B. Lemaitre (Buchon et al., 2009)42 N/A Software and algorithms Prism 9 GraphPad Software RRID:SCR_002798 Fiji NIH RRID:SCR_002285 bwa-mem version 0.7.17 H. Li arXiv:1303.3997v2 [q-bio.GN] FastQC S. Andrews http://www.bioinformatics.babraham. ac.uk/projects/fastqc bamstats bamstats https://biopet.github.io/bamstats/ 1.0.1/index.html multiqc mutliqc https://doi.org/10.1093/bioinformatics/btw354 SAMtools SAMtools https://www.htslib.org/ Gigascience.
Sample Prep:Article Title: Oryza sativa Baby Boom1 converts the developmental fate of rice egg cells from gametic into somatic status
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples WT egg cells This study N/A DD45p::OsBBM1 egg cells This study N/A Chemicals, peptides, and recombinant proteins PrepManTM Ultra Sample Preparation Reagent Thermo Fisher Scientific, Warrington, UK REF 4318930 Agencourt AMPure XP beads Beckman Coulter, Brea, CA, USA Cat# NC9933872 SCRI Renaissance Stain 2200 Renaissance chemical, Japan SR2200 Critical commercial assays SMART-Seq HT Kit Takara Bio, Shiga, Japan Cat# 634456 Nextera® XT DNA Library Prep Kit Illumina, San Diego, CA, USA REF 15032350 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific, Waltham, MA, USA REF Q32852 Deposited data Sequencing data reported in this paper NCBI database PRJNA1256131 Experimental models: Rice plants Oryza sativa This study N/A DD45p::OsBBM1-2 This study N/A DD45p::OsBBM1-7 This study N/A DD45p::OsBBM1-8 This study N/A Oligonucleotides For primer used see Table S1 This study N/A For primer used see Table S7 This study N/A Recombinant DNA Plasmid: DD45p::OsBBM1 This study N/A Software and algorithms BX-73 inverted microscope Olympus, Japan N/A DP73 digital camera Olympus, Japan N/A cellSen® Standard Olympus, Japan N/A Nikon C2 confocal microscope (Ver.450) Nikon NIS-Elements AR, Tokyo, Japan N/A FastQC (v0.11.8) Simon46 https://www.bioinformatics.babraham.ac.uk/projects Cutadapt (v2.10) Martin47 https://doi.org/10.14806/ej.17.1.200 RSEM (v1.3.1) Li and Dewey48 http://www.biomedcentral.com/1471-2105/12/323 Bowtie2 (v 2.3.5.1) Langmead and Salzberg49 https://doi.org/10.1038/nmeth.1923 TCC (Tag Count Comparison) Sun et al.50 http://www.biomedcentral.com/1471-2105/14/219 GO analysis tool (agriGO v2.0) Tian et al.51 https://doi.org/10.1093/nar/gkx382 Other Oc Riken Bio-Resource Center, Tsukuba, Japan N/A e1 iScience 28, 113621, October 17, 2025 ..
Plasmid Preparation:Article Title: Oryza sativa Baby Boom1 converts the developmental fate of rice egg cells from gametic into somatic status
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples WT egg cells This study N/A DD45p::OsBBM1 egg cells This study N/A Chemicals, peptides, and recombinant proteins PrepManTM Ultra Sample Preparation Reagent Thermo Fisher Scientific, Warrington, UK REF 4318930 Agencourt AMPure XP beads Beckman Coulter, Brea, CA, USA Cat# NC9933872 SCRI Renaissance Stain 2200 Renaissance chemical, Japan SR2200 Critical commercial assays SMART-Seq HT Kit Takara Bio, Shiga, Japan Cat# 634456 Nextera® XT DNA Library Prep Kit Illumina, San Diego, CA, USA REF 15032350 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific, Waltham, MA, USA REF Q32852 Deposited data Sequencing data reported in this paper NCBI database PRJNA1256131 Experimental models: Rice plants Oryza sativa This study N/A DD45p::OsBBM1-2 This study N/A DD45p::OsBBM1-7 This study N/A DD45p::OsBBM1-8 This study N/A Oligonucleotides For primer used see Table S1 This study N/A For primer used see Table S7 This study N/A Recombinant DNA Plasmid: DD45p::OsBBM1 This study N/A Software and algorithms BX-73 inverted microscope Olympus, Japan N/A DP73 digital camera Olympus, Japan N/A cellSen® Standard Olympus, Japan N/A Nikon C2 confocal microscope (Ver.450) Nikon NIS-Elements AR, Tokyo, Japan N/A FastQC (v0.11.8) Simon46 https://www.bioinformatics.babraham.ac.uk/projects Cutadapt (v2.10) Martin47 https://doi.org/10.14806/ej.17.1.200 RSEM (v1.3.1) Li and Dewey48 http://www.biomedcentral.com/1471-2105/12/323 Bowtie2 (v 2.3.5.1) Langmead and Salzberg49 https://doi.org/10.1038/nmeth.1923 TCC (Tag Count Comparison) Sun et al.50 http://www.biomedcentral.com/1471-2105/14/219 GO analysis tool (agriGO v2.0) Tian et al.51 https://doi.org/10.1093/nar/gkx382 Other Oc Riken Bio-Resource Center, Tsukuba, Japan N/A e1 iScience 28, 113621, October 17, 2025 ..
Inverted Microscopy:Article Title: Oryza sativa Baby Boom1 converts the developmental fate of rice egg cells from gametic into somatic status
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples WT egg cells This study N/A DD45p::OsBBM1 egg cells This study N/A Chemicals, peptides, and recombinant proteins PrepManTM Ultra Sample Preparation Reagent Thermo Fisher Scientific, Warrington, UK REF 4318930 Agencourt AMPure XP beads Beckman Coulter, Brea, CA, USA Cat# NC9933872 SCRI Renaissance Stain 2200 Renaissance chemical, Japan SR2200 Critical commercial assays SMART-Seq HT Kit Takara Bio, Shiga, Japan Cat# 634456 Nextera® XT DNA Library Prep Kit Illumina, San Diego, CA, USA REF 15032350 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific, Waltham, MA, USA REF Q32852 Deposited data Sequencing data reported in this paper NCBI database PRJNA1256131 Experimental models: Rice plants Oryza sativa This study N/A DD45p::OsBBM1-2 This study N/A DD45p::OsBBM1-7 This study N/A DD45p::OsBBM1-8 This study N/A Oligonucleotides For primer used see Table S1 This study N/A For primer used see Table S7 This study N/A Recombinant DNA Plasmid: DD45p::OsBBM1 This study N/A Software and algorithms BX-73 inverted microscope Olympus, Japan N/A DP73 digital camera Olympus, Japan N/A cellSen® Standard Olympus, Japan N/A Nikon C2 confocal microscope (Ver.450) Nikon NIS-Elements AR, Tokyo, Japan N/A FastQC (v0.11.8) Simon46 https://www.bioinformatics.babraham.ac.uk/projects Cutadapt (v2.10) Martin47 https://doi.org/10.14806/ej.17.1.200 RSEM (v1.3.1) Li and Dewey48 http://www.biomedcentral.com/1471-2105/12/323 Bowtie2 (v 2.3.5.1) Langmead and Salzberg49 https://doi.org/10.1038/nmeth.1923 TCC (Tag Count Comparison) Sun et al.50 http://www.biomedcentral.com/1471-2105/14/219 GO analysis tool (agriGO v2.0) Tian et al.51 https://doi.org/10.1093/nar/gkx382 Other Oc Riken Bio-Resource Center, Tsukuba, Japan N/A e1 iScience 28, 113621, October 17, 2025 ..
Microscopy:Article Title: Oryza sativa Baby Boom1 converts the developmental fate of rice egg cells from gametic into somatic status
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples WT egg cells This study N/A DD45p::OsBBM1 egg cells This study N/A Chemicals, peptides, and recombinant proteins PrepManTM Ultra Sample Preparation Reagent Thermo Fisher Scientific, Warrington, UK REF 4318930 Agencourt AMPure XP beads Beckman Coulter, Brea, CA, USA Cat# NC9933872 SCRI Renaissance Stain 2200 Renaissance chemical, Japan SR2200 Critical commercial assays SMART-Seq HT Kit Takara Bio, Shiga, Japan Cat# 634456 Nextera® XT DNA Library Prep Kit Illumina, San Diego, CA, USA REF 15032350 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific, Waltham, MA, USA REF Q32852 Deposited data Sequencing data reported in this paper NCBI database PRJNA1256131 Experimental models: Rice plants Oryza sativa This study N/A DD45p::OsBBM1-2 This study N/A DD45p::OsBBM1-7 This study N/A DD45p::OsBBM1-8 This study N/A Oligonucleotides For primer used see Table S1 This study N/A For primer used see Table S7 This study N/A Recombinant DNA Plasmid: DD45p::OsBBM1 This study N/A Software and algorithms BX-73 inverted microscope Olympus, Japan N/A DP73 digital camera Olympus, Japan N/A cellSen® Standard Olympus, Japan N/A Nikon C2 confocal microscope (Ver.450) Nikon NIS-Elements AR, Tokyo, Japan N/A FastQC (v0.11.8) Simon46 https://www.bioinformatics.babraham.ac.uk/projects Cutadapt (v2.10) Martin47 https://doi.org/10.14806/ej.17.1.200 RSEM (v1.3.1) Li and Dewey48 http://www.biomedcentral.com/1471-2105/12/323 Bowtie2 (v 2.3.5.1) Langmead and Salzberg49 https://doi.org/10.1038/nmeth.1923 TCC (Tag Count Comparison) Sun et al.50 http://www.biomedcentral.com/1471-2105/14/219 GO analysis tool (agriGO v2.0) Tian et al.51 https://doi.org/10.1093/nar/gkx382 Other Oc Riken Bio-Resource Center, Tsukuba, Japan N/A e1 iScience 28, 113621, October 17, 2025 ..
Comparison:Article Title: Oryza sativa Baby Boom1 converts the developmental fate of rice egg cells from gametic into somatic status
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples WT egg cells This study N/A DD45p::OsBBM1 egg cells This study N/A Chemicals, peptides, and recombinant proteins PrepManTM Ultra Sample Preparation Reagent Thermo Fisher Scientific, Warrington, UK REF 4318930 Agencourt AMPure XP beads Beckman Coulter, Brea, CA, USA Cat# NC9933872 SCRI Renaissance Stain 2200 Renaissance chemical, Japan SR2200 Critical commercial assays SMART-Seq HT Kit Takara Bio, Shiga, Japan Cat# 634456 Nextera® XT DNA Library Prep Kit Illumina, San Diego, CA, USA REF 15032350 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific, Waltham, MA, USA REF Q32852 Deposited data Sequencing data reported in this paper NCBI database PRJNA1256131 Experimental models: Rice plants Oryza sativa This study N/A DD45p::OsBBM1-2 This study N/A DD45p::OsBBM1-7 This study N/A DD45p::OsBBM1-8 This study N/A Oligonucleotides For primer used see Table S1 This study N/A For primer used see Table S7 This study N/A Recombinant DNA Plasmid: DD45p::OsBBM1 This study N/A Software and algorithms BX-73 inverted microscope Olympus, Japan N/A DP73 digital camera Olympus, Japan N/A cellSen® Standard Olympus, Japan N/A Nikon C2 confocal microscope (Ver.450) Nikon NIS-Elements AR, Tokyo, Japan N/A FastQC (v0.11.8) Simon46 https://www.bioinformatics.babraham.ac.uk/projects Cutadapt (v2.10) Martin47 https://doi.org/10.14806/ej.17.1.200 RSEM (v1.3.1) Li and Dewey48 http://www.biomedcentral.com/1471-2105/12/323 Bowtie2 (v 2.3.5.1) Langmead and Salzberg49 https://doi.org/10.1038/nmeth.1923 TCC (Tag Count Comparison) Sun et al.50 http://www.biomedcentral.com/1471-2105/14/219 GO analysis tool (agriGO v2.0) Tian et al.51 https://doi.org/10.1093/nar/gkx382 Other Oc Riken Bio-Resource Center, Tsukuba, Japan N/A e1 iScience 28, 113621, October 17, 2025 ..
Lysis:Article Title: Isolation and transcriptional profiling of antigen-presenting cells from mouse lung and MLNs following intranasal immunization.
Article Snippet: Wang et al., STAR Protocols 5, 103400 December 20, 2024 a 2024 Dendritic cells (DCs) play a central role in the initiation of the adaptive immune response.. Here, we present a protocol for isolating and transcriptionally profiling antigen-presenting cells (APCs) from the mouse lung andmediastinal lymph nodes (MLNs) following intranasal immunization.. We describe steps for preparing single-cell suspensions from the lung and MLN, along with the detection and RNA sequencing (RNA-seq) of antigen-presenting DCs.
Fluorescence:Article Title: Isolation and transcriptional profiling of antigen-presenting cells from mouse lung and MLNs following intranasal immunization.
Article Snippet: Wang et al., STAR Protocols 5, 103400 December 20, 2024 a 2024 Dendritic cells (DCs) play a central role in the initiation of the adaptive immune response.. Here, we present a protocol for isolating and transcriptionally profiling antigen-presenting cells (APCs) from the mouse lung andmediastinal lymph nodes (MLNs) following intranasal immunization.. We describe steps for preparing single-cell suspensions from the lung and MLN, along with the detection and RNA sequencing (RNA-seq) of antigen-presenting DCs.
RNAscope:Article Title: Molecular underpinnings and environmental drivers of loss of heterozygosity in Drosophila intestinal stem cells.
Article Snippet: .. Cell Reports 42, 113485, December 26, 2023 13 Article ll OPEN ACCESS STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Delta ECD (1:1000) DSHB Cat# c594.9b, RRID: AB_528194 Mouse anti-Prospero (1:1000) DSHB Cat# Prospero (MR1A-c) RRID: AB_528440 Chicken anti-GFP (1:2000) Invitrogen Cat# A10262 RRID: AB_2534023 Rabbit anti-Histone H2AvD pS137 (1:1000) Rockland Cat# 600-401-914 RRID: AB_828383 Rabbit anti-PH3 (1:2000) Millipore Cat# 06–570 RRID: AB_310177 Chemicals, peptides, and recombinant proteins RNAscope probes – Pif1 ACD bioteche NM_001298658.1 RNAscope probes – SpnA ACD bioteche NM_079844.4 Critical commercial assays QIAquick PCR Purification Kit Qiagen Cat# 28104 QIAmp DNA Micro Kit Qiagen Cat# 56304 RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Cat#323100 Nextera XT DNA Library Prep Kit Illumina Cat# FC-121-1030 KAPA HyperPlus Kit ROCHE Cat#07962380001 KAPA Library Quanitification Kits ROCHE Cat#07960140001 Deposited data NCBI BioProject database NCBI: PRJNA858414 https://www.ncbi.nlm.nih.gov/bioproject/ Experimental models: Organisms/strains Drosophila: UAS-GFPnls Bloomington Drosophila Stock Center RRID:BDSC_4776 Drosophila: SpnA093 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: SpnA057 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: w[1118] M. McVey N/A Drosophila: Gen[z4325] J. Sekelsky (Andersen, 2011)95 N/A Drosophila: mus81[nhe1] J. Sekelsky (Trowbridge, 2007)96 N/A Drosophila: prosvoila-GAL4 J. .. De Navascués (Balakireva, 1998)97 N/A Drosophila: Su(H)D47 F. Schweisguth RRID:BDSC_51215 Drosophila: UAS-DAP B. Edgar (Reis, 2004)65 N/A Drosophila: UAS-CycE,UAS-stg B. Edgar (Kohlmaier, 2015)66 N/A Drosophila: tubGAL80ts Dl-GAL4 B. Edgar (Zeng, 2010)98 N/A Drosophila: Rad51 (spnA)RNAi VDRC #13362 Drosophila: Pif1RNAi VDRC #34533 Drosophila: engrailed-GAL4 UAS-GFP Y. Bellaiche N/A Pseudomonas entomophila B. Lemaitre (Jiang et al., 2009)43 N/A (Continued on next page) 14 Cell Reports 42, 113485, December 26, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Erwinia carotovora carotovora 15 (Ecc15) B. Lemaitre (Buchon et al., 2009)42 N/A Software and algorithms Prism 9 GraphPad Software RRID:SCR_002798 Fiji NIH RRID:SCR_002285 bwa-mem version 0.7.17 H. Li arXiv:1303.3997v2 [q-bio.GN] FastQC S. Andrews http://www.bioinformatics.babraham. ac.uk/projects/fastqc bamstats bamstats https://biopet.github.io/bamstats/ 1.0.1/index.html multiqc mutliqc https://doi.org/10.1093/bioinformatics/btw354 SAMtools SAMtools https://www.htslib.org/ Gigascience.
Purification:Article Title: Molecular underpinnings and environmental drivers of loss of heterozygosity in Drosophila intestinal stem cells.
Article Snippet: .. Cell Reports 42, 113485, December 26, 2023 13 Article ll OPEN ACCESS STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Delta ECD (1:1000) DSHB Cat# c594.9b, RRID: AB_528194 Mouse anti-Prospero (1:1000) DSHB Cat# Prospero (MR1A-c) RRID: AB_528440 Chicken anti-GFP (1:2000) Invitrogen Cat# A10262 RRID: AB_2534023 Rabbit anti-Histone H2AvD pS137 (1:1000) Rockland Cat# 600-401-914 RRID: AB_828383 Rabbit anti-PH3 (1:2000) Millipore Cat# 06–570 RRID: AB_310177 Chemicals, peptides, and recombinant proteins RNAscope probes – Pif1 ACD bioteche NM_001298658.1 RNAscope probes – SpnA ACD bioteche NM_079844.4 Critical commercial assays QIAquick PCR Purification Kit Qiagen Cat# 28104 QIAmp DNA Micro Kit Qiagen Cat# 56304 RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Cat#323100 Nextera XT DNA Library Prep Kit Illumina Cat# FC-121-1030 KAPA HyperPlus Kit ROCHE Cat#07962380001 KAPA Library Quanitification Kits ROCHE Cat#07960140001 Deposited data NCBI BioProject database NCBI: PRJNA858414 https://www.ncbi.nlm.nih.gov/bioproject/ Experimental models: Organisms/strains Drosophila: UAS-GFPnls Bloomington Drosophila Stock Center RRID:BDSC_4776 Drosophila: SpnA093 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: SpnA057 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: w[1118] M. McVey N/A Drosophila: Gen[z4325] J. Sekelsky (Andersen, 2011)95 N/A Drosophila: mus81[nhe1] J. Sekelsky (Trowbridge, 2007)96 N/A Drosophila: prosvoila-GAL4 J. .. De Navascués (Balakireva, 1998)97 N/A Drosophila: Su(H)D47 F. Schweisguth RRID:BDSC_51215 Drosophila: UAS-DAP B. Edgar (Reis, 2004)65 N/A Drosophila: UAS-CycE,UAS-stg B. Edgar (Kohlmaier, 2015)66 N/A Drosophila: tubGAL80ts Dl-GAL4 B. Edgar (Zeng, 2010)98 N/A Drosophila: Rad51 (spnA)RNAi VDRC #13362 Drosophila: Pif1RNAi VDRC #34533 Drosophila: engrailed-GAL4 UAS-GFP Y. Bellaiche N/A Pseudomonas entomophila B. Lemaitre (Jiang et al., 2009)43 N/A (Continued on next page) 14 Cell Reports 42, 113485, December 26, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Erwinia carotovora carotovora 15 (Ecc15) B. Lemaitre (Buchon et al., 2009)42 N/A Software and algorithms Prism 9 GraphPad Software RRID:SCR_002798 Fiji NIH RRID:SCR_002285 bwa-mem version 0.7.17 H. Li arXiv:1303.3997v2 [q-bio.GN] FastQC S. Andrews http://www.bioinformatics.babraham. ac.uk/projects/fastqc bamstats bamstats https://biopet.github.io/bamstats/ 1.0.1/index.html multiqc mutliqc https://doi.org/10.1093/bioinformatics/btw354 SAMtools SAMtools https://www.htslib.org/ Gigascience.
Multiplex Assay:Article Title: Molecular underpinnings and environmental drivers of loss of heterozygosity in Drosophila intestinal stem cells.
Article Snippet: .. Cell Reports 42, 113485, December 26, 2023 13 Article ll OPEN ACCESS STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Delta ECD (1:1000) DSHB Cat# c594.9b, RRID: AB_528194 Mouse anti-Prospero (1:1000) DSHB Cat# Prospero (MR1A-c) RRID: AB_528440 Chicken anti-GFP (1:2000) Invitrogen Cat# A10262 RRID: AB_2534023 Rabbit anti-Histone H2AvD pS137 (1:1000) Rockland Cat# 600-401-914 RRID: AB_828383 Rabbit anti-PH3 (1:2000) Millipore Cat# 06–570 RRID: AB_310177 Chemicals, peptides, and recombinant proteins RNAscope probes – Pif1 ACD bioteche NM_001298658.1 RNAscope probes – SpnA ACD bioteche NM_079844.4 Critical commercial assays QIAquick PCR Purification Kit Qiagen Cat# 28104 QIAmp DNA Micro Kit Qiagen Cat# 56304 RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Cat#323100 Nextera XT DNA Library Prep Kit Illumina Cat# FC-121-1030 KAPA HyperPlus Kit ROCHE Cat#07962380001 KAPA Library Quanitification Kits ROCHE Cat#07960140001 Deposited data NCBI BioProject database NCBI: PRJNA858414 https://www.ncbi.nlm.nih.gov/bioproject/ Experimental models: Organisms/strains Drosophila: UAS-GFPnls Bloomington Drosophila Stock Center RRID:BDSC_4776 Drosophila: SpnA093 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: SpnA057 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: w[1118] M. McVey N/A Drosophila: Gen[z4325] J. Sekelsky (Andersen, 2011)95 N/A Drosophila: mus81[nhe1] J. Sekelsky (Trowbridge, 2007)96 N/A Drosophila: prosvoila-GAL4 J. .. De Navascués (Balakireva, 1998)97 N/A Drosophila: Su(H)D47 F. Schweisguth RRID:BDSC_51215 Drosophila: UAS-DAP B. Edgar (Reis, 2004)65 N/A Drosophila: UAS-CycE,UAS-stg B. Edgar (Kohlmaier, 2015)66 N/A Drosophila: tubGAL80ts Dl-GAL4 B. Edgar (Zeng, 2010)98 N/A Drosophila: Rad51 (spnA)RNAi VDRC #13362 Drosophila: Pif1RNAi VDRC #34533 Drosophila: engrailed-GAL4 UAS-GFP Y. Bellaiche N/A Pseudomonas entomophila B. Lemaitre (Jiang et al., 2009)43 N/A (Continued on next page) 14 Cell Reports 42, 113485, December 26, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Erwinia carotovora carotovora 15 (Ecc15) B. Lemaitre (Buchon et al., 2009)42 N/A Software and algorithms Prism 9 GraphPad Software RRID:SCR_002798 Fiji NIH RRID:SCR_002285 bwa-mem version 0.7.17 H. Li arXiv:1303.3997v2 [q-bio.GN] FastQC S. Andrews http://www.bioinformatics.babraham. ac.uk/projects/fastqc bamstats bamstats https://biopet.github.io/bamstats/ 1.0.1/index.html multiqc mutliqc https://doi.org/10.1093/bioinformatics/btw354 SAMtools SAMtools https://www.htslib.org/ Gigascience.
Mutagenesis:Article Title: Molecular underpinnings and environmental drivers of loss of heterozygosity in Drosophila intestinal stem cells.
Article Snippet: .. Cell Reports 42, 113485, December 26, 2023 13 Article ll OPEN ACCESS STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Delta ECD (1:1000) DSHB Cat# c594.9b, RRID: AB_528194 Mouse anti-Prospero (1:1000) DSHB Cat# Prospero (MR1A-c) RRID: AB_528440 Chicken anti-GFP (1:2000) Invitrogen Cat# A10262 RRID: AB_2534023 Rabbit anti-Histone H2AvD pS137 (1:1000) Rockland Cat# 600-401-914 RRID: AB_828383 Rabbit anti-PH3 (1:2000) Millipore Cat# 06–570 RRID: AB_310177 Chemicals, peptides, and recombinant proteins RNAscope probes – Pif1 ACD bioteche NM_001298658.1 RNAscope probes – SpnA ACD bioteche NM_079844.4 Critical commercial assays QIAquick PCR Purification Kit Qiagen Cat# 28104 QIAmp DNA Micro Kit Qiagen Cat# 56304 RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Cat#323100 Nextera XT DNA Library Prep Kit Illumina Cat# FC-121-1030 KAPA HyperPlus Kit ROCHE Cat#07962380001 KAPA Library Quanitification Kits ROCHE Cat#07960140001 Deposited data NCBI BioProject database NCBI: PRJNA858414 https://www.ncbi.nlm.nih.gov/bioproject/ Experimental models: Organisms/strains Drosophila: UAS-GFPnls Bloomington Drosophila Stock Center RRID:BDSC_4776 Drosophila: SpnA093 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: SpnA057 mutant M. McVey (Staeva-Vieira, 2003)94 N/A Drosophila: w[1118] M. McVey N/A Drosophila: Gen[z4325] J. Sekelsky (Andersen, 2011)95 N/A Drosophila: mus81[nhe1] J. Sekelsky (Trowbridge, 2007)96 N/A Drosophila: prosvoila-GAL4 J. .. De Navascués (Balakireva, 1998)97 N/A Drosophila: Su(H)D47 F. Schweisguth RRID:BDSC_51215 Drosophila: UAS-DAP B. Edgar (Reis, 2004)65 N/A Drosophila: UAS-CycE,UAS-stg B. Edgar (Kohlmaier, 2015)66 N/A Drosophila: tubGAL80ts Dl-GAL4 B. Edgar (Zeng, 2010)98 N/A Drosophila: Rad51 (spnA)RNAi VDRC #13362 Drosophila: Pif1RNAi VDRC #34533 Drosophila: engrailed-GAL4 UAS-GFP Y. Bellaiche N/A Pseudomonas entomophila B. Lemaitre (Jiang et al., 2009)43 N/A (Continued on next page) 14 Cell Reports 42, 113485, December 26, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Erwinia carotovora carotovora 15 (Ecc15) B. Lemaitre (Buchon et al., 2009)42 N/A Software and algorithms Prism 9 GraphPad Software RRID:SCR_002798 Fiji NIH RRID:SCR_002285 bwa-mem version 0.7.17 H. Li arXiv:1303.3997v2 [q-bio.GN] FastQC S. Andrews http://www.bioinformatics.babraham. ac.uk/projects/fastqc bamstats bamstats https://biopet.github.io/bamstats/ 1.0.1/index.html multiqc mutliqc https://doi.org/10.1093/bioinformatics/btw354 SAMtools SAMtools https://www.htslib.org/ Gigascience.
SYBR Green Assay:
|
Illumina Inc is a verified supplier 